Protocol 14858 - Ptprc<a><b>

Notes

This genotyping assay uses pyrosequencing technology and is run on the Biotage PSQ 96MA. The Jackson Laboratory is not posting the complete details of our pyrosequencing genotyping assays as the primers for pyrosequencing cannot be used for sequencing using more traditional methods. The wild type and mutant nucleotides and the flanking DNA sequence are provided below.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Amplicon = 237 bp
HET = C/T
HOM (Ptprc<a>) = C/C
WT (Ptprc<b>) = T/T

Sequence

TCAAACTATTATCTTAAGCAAGTAGCTGTGGATATAAACTATGTCTCATTAATTTTATTTTAATACTTACCACAGCAATACCTCAAGATACCAAAACACATGGCCAACTGTGGGAATATTCTGATAGAAGAGAATATTATTGGGTAGTCTTCAGATCAGTGGGATAACTAGCCAAAAAGAATCTATGAAAGAAATCTAATCTAAATGATCCAGGATAGGTCTAAGAACTTCACTGAGATTTTATTAATTCACAATTAATCAAAAGATAGGTATTCATGATTCAAGCTGGCTATGTAAATACTTCTTTTCAGTGTCTTATTTTTCCCATTATAACTTTTTCTGTTTTTAACAGTTCCAGAAACGCCTAAGCCTAGTTGTGGGGATCCAGCTGCAAGAAAAACGTTAGTCTCTTGGCCTGAGCCTG(T/C)ATCTAAACCTGA(G/T)(T/C)CTGCATCTAAACCCCATGGATATGTTTTATGCTATAAGAACAATTCAGGTAATGTAAAATTCCACTAGGGAAACAAAATCAAGAATTTTTAAATGTTGTAATTATTGTTTTAGCCAGGGAGCTACAAGGCTTTTATGAAGGTGATGAGAGATTCATGTTTGAGTTTGCTTAGATGAACACGCATCTCATGGAGAAGAATAAATATCTAGATCATTTATTAAAAATAGTGGACAGGACTAGAGTCCTTTAGAGCAGGTTACTCATCAGGACATTCCTTTATCTCTGGGCTAAGGTGGGAATGTACTTAGCTCTCATAGAEdit

Twelve nucleotide differences between the a and b alleles have been identified. This assay is designed to detect a T to C point mutation (indicated in red), however, additional nucleotide differences in close proximity have been indicated in green.

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'
12964	Fluorophore	AAC GTT AGT CTC TTG GCC TGA GC
12965	Fluorophore	CTT CTC CAT GAG ATG CGT GTT C
12966		TCT CTT GGC CTG AGC

Reaction A

Component	Final Concentration
ddH2O
Kapa 2G HS buffer	1.00
MgCl2	2.00
dNTPS-kapa	0.20
12964	0.50
12965	0.50
Glycerol	5.00
Kapa 2G HS taq polym	0.01
DNA

Cycling

Step	Temp °C	Time	Note
1	94.0	--
2	94.0	--
3	65.0	--	-0.5 C per cycle decrease
4	68.0	--
5		--	repeat steps 2-4 for 10 cycles
6	94.0	--
7	60.0	--
8	72.0	--
9		--	repeat steps 6-8 for 28 cycles
10	72.0	--
11	10.0	--	hold

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number	Strain Name
007594	B6.129P2-Ptprc^a Igh^tm1Mnz/J
006447	B6.129S6(CBA)-Cebpa^tm1Dgt/J
002014	B6.SJL-Ptprc^a Pepc^b/BoyJ
018869	C.129S4(Cg)-Il13^tm2.1Lky/J
4 strains use this protocol