For in-depth product & services help, ask our
Technical Information Scientists
Notes
This assay cannot distinguish hemi from hom
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Tg= 85 bp
IPC = 74 bp
This assay distinguishes GCaMP6s from GCaMP6f and GCaMP3
Sequence
aagacaggtcacgcagtcagagctataggtcggctgagctcactcgagaacgtctatatcaaggccgacaagcagaagaacggcatcaaggcgaacttc[CaC]atccgccacaacatcgaggacggcggcgtgcagctcgcctaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaacc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 27656 | TGG TAG TGG TAG GCG AGC TG | Transgene Reverse | A | |||
| 31033 | ACA AGC AGA AGA ACG GCA TC | Transgene Forward | A | |||
| 31034 | Fluorophore-1 | CGA ACT TCC ACA TCC GCC | Quencher-1 | Tg Probe | ||
| oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
| oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
| TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 27656 | 0.40 uM |
| 31033 | 0.40 uM |
| oIMR1544 | 0.40 uM |
| oIMR3580 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 024115 | B6.Cg-Igs7tm94.1(tetO-GCaMP6s)Hze Tg(Camk2a-tTA)1Mmay/J |
| 024104 | B6.Cg-Igs7tm94.1(tetO-GCaMP6s)Hze/J |
| 025776 | C57BL/6J-Tg(Thy1-GCaMP6s)GP4.12Dkim/J |
| 024275 | C57BL/6J-Tg(Thy1-GCaMP6s)GP4.3Dkim/J |
| 028278 | C57BL/6J-Tg(Thy1-GCaMP6s)GP4.6Dkim/J |
| 024112 | STOCK Gt(ROSA)26Sortm5(ACTB-tTA)Luo Igs7tm94.1(tetO-GCaMP6s)Hze/J |
| 6 strains use this protocol | |