Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 145 bp
Wild Type = 63 bp
Wt Sequence:tccatggattgctgtattggaatcaaacagaaatctatgtcattcacagcagtaacctcctgggaatacttcaagagacggagaaagggcgactgactgtgccctccgtcctttttcgcaatcctttattCTGTTCGAAtcataatttgt
tttcctgagacagggtttctctgtgtagtcctggctgtcctgggactcccctctgtagaccaggctggcctccaactgtctctgcctcctatgtgctgggatcaaaggtgcctgccaccaccgcctggcttcttagagttgg
Mutant Sequence:GAGACGGAGAAAGGGCGACTGACTGTGCCCTCCGTCCTTTTTCGCAATCCTTTATTCTGTTCGAtaagcttgatatcgaattcataacttcgtataatgtatgctatacgaagttatctgcagcccg
ggggatctgatatcaTCGAATCATAATTTGTTTTCCTGAGACAGGGTTTCTCTGTGTAGTCCTGGCTGTCCTGGGACTCCCCTCTGTAGACCAG
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
31852 | CGT CCT TTT TCG CAA TCC T | Forward | A | |||
31853 | GAA ACC CTG TCT CAG GAA AAC | Reverse | A | |||
31854 | Fluorophore-1 | CAA TCC TTT ATT CTG TTC GAA TCA T | Quencher-1 | WT Probe | ||
31855 | Fluorophore-2 | TGC TAT ACG AAG TTA TCT GCA GCC | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
31852 | 0.40 uM |
31853 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
Stock Number | Strain Name |
---|---|
026512 | B6(Cg)-Tg(TPO-cre/ERT2)1139Tyj/J |
032435 | B6.129-Krastm4Tyj Trp53tm1Brn/J |
037954 | B6.Cg-Gt(ROSA)26Sortm4(CAG-cas9*/GAG-POL,-mNeonGreen)Tyj Trp53tm1Brn/TyjJ |
033754 | STOCK Brca2tm1Brn Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
033755 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
033756 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn/Trp53tm3Tyj Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
032429 | STOCK Krastm4Tyj Trp53tm1Brn Tg(Pdx1-cre/Esr1*)#Dam/J |
7 strains use this protocol |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.