For in-depth product & services help, ask our
Technical Information Scientists
Notes
Mut = C
WT= G
No product will amplify in Wt.
This assay is an absence presence assay and cannot distinguish het from hom.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
GATACCCTTCCATAGGGGCTTGAGCACAGAATCAAAAGACTCAATACCATAAGGAGTTGCTGCCTCAGCCAAAGCAGCAATGGCCAGAGCACTGATGGTCCGAACTT(C/G)CTGCTGC
TCATCCACGAGACctatacaatcagacatggttatgagtaggtacccacacctaattttcataatacaatccaaattttagcaatgtatctaaccatgtatccaaactgcaataatttttttatagtacataaaatttaggcaatgataacttcgtataatgtat
gctatacgaagttatgcggccgcataacttcgtataggataccttatacgaagtTATTTAgatacattgctaaaatttggattgcattacgaaaattaggtattggtacctactcataactgtgttggattgttttgtgttttgcc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 31765 | CAA TCC AAC ACA GTT ATG AGT AGG T | Reverse | A | |||
| 32316 | CAT AAG GAG TTG CTG CCT CA | Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 31765 | 0.50 uM |
| 32316 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.