For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 92 bp
Wild Type = 125 bp
Sequence
Wt Sequence: gctcatacacgggtgtgctcacggctgcagtgataagtggcttagtcccagaagtacaaatggtgaggagtggtggaggacatggcccctggtacctgCagaggctctatgggaaggctgacaggtggatcCCgggggcgggggtggag
gggtgctggactcagaggcaggcagctggaatcttcctggggccagcctggaagggtaagagaggacccagatatagggctttaggcacctcccgaaggcgatgtttgcttctctcttcctctttagtctaccttggtgctccctttaagtgatggaag
gaactgtctcttccggctgg
Mutant Sequence: GGTTCAGTGGCCTGACCCCCTGGATCACGGGTGTGCTCATACACGGGTGTGCTCACGGCTGCAGTGATAAGTGGCTTAGTCCCAGAAGTACAAATGGTGAGGAGTGGTGAAGG
ACATGGCCCCTGGTACCTGCAGAGGCTCTATGGGAAGGCTGACAGGTGGATCCatcgattctagagatatcctcgagggcccctgcaggtcaattctaccgggtaggggaggcgcttttcccaaggcagtctggag
catgcgctttagcagccccgctgggcact
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33082 | TCT ATG GGA AGG CTG ACA GG | Common | A | |||
| 33083 | AGC CCT ATA TCT GGG TCC TCT | Wild type Reverse | A | |||
| 33084 | Fluorophore-1 | CCC CTG CAG GTC AAT TCT ACC | Quencher-1 | MUT Probe | ||
| 33085 | Fluorophore-2 | CTT CCT GGG GCC AGC CT | Quencher-2 | WT Probe | ||
| oIMR6592 | GAA AAG CGC CTC CCC TAC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33082 | 0.40 uM |
| 33083 | 0.40 uM |
| oIMR6592 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.