For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T/T
Heterozygote = C/T
Wild type = C/C
X-linked mutation
Sequence
TGTTTAGATCTCTAAATTACATAAACTTTTATTTACCTTCTTCTTGATATGAATGAAACT
CATCAAATATGCGTGTTAGTGTAAATGAACTTCTATTTAATTTTGAGGCTCTGCAAAGT
TCTTTGAAAGAGCAA(c/t)AAAATGGCTTCAACTATCTGAGTGACACTGTGAAGGAGA
TGGCCAAGAAAGCACCTTCAGAAATATGCCAGAAATATCTGTCAGAATTTGAAGAGA
TTGAGGGGCACTGGAAGAAACTTTCCTCCCAGTTGGTGGAAAGCTGCCAAAAGCTA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 16077 | ATT TTG AGG CTC TGC AAA GTT C | Forward | A | |||
| 16078 | GCC CCT CAA TCT CTT CAA ATT C | Reverse | A | |||
| 16079 | Fluorophore-1 | TGA AAG AGC AAC AAA ATG GCT TC | Quencher-1 | WT Probe | ||
| 16080 | Fluorophore-2 | TGA AAG AGC AAT AAA ATG GCT TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 16077 | 0.40 uM |
| 16078 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 017929 | B10.Cg-Cmahtm1Avrk Dmdmdx/PtmJ |
| 027818 | B10.Cg-Dmdmdx Tg(ACTA1-DMD*)326Dua/Mmjax |
| 027820 | B10.Cg-Dmdmdx Tg(Myh6-DMD*)#Dua/Mmjax |
| 027819 | B10.Cg-Dmdmdx Tg(Myh6-DMD*)47Dua/Mmjax |
| 018018 | B10ScSn.Cg-Prkdcscid Dmdmdx/J |
| 019014 | B10ScSn.Cg-Utrntm1Ked Dmdmdx/J |
| 027821 | B6.B10-Dmdmdx/Mmjax |
| 027822 | C.B10-Dmdmdx/Mmjax |
| 001801 | C57BL/10ScSn-Dmdmdx/J |
| 013141 | D2.B10-Dmdmdx/J |
| 022506 | D2.Cg-Utrntm1Ked Dmdmdx/J |
| 038371 | D2.Cg-Tg(DMD*)#Spc Dmdmdx/J |
| 027823 | FVB.Cg-Dmdmdx Tg(Myh6-DMD*)271Dua/Mmjax |
| 018915 | STOCK Terctm1Rdp Dmdmdx/J |
| 016622 | STOCK Utrntm1Jrs Dmdmdx/J |
| 014563 | STOCK Utrntm1Ked Dmdmdx/J |
| 16 strains use this protocol | |