Protocol 22134: QPCR Assay - TG(KITLG)
Version 2.0

Notes

Taqman qPCR protocols are run on an ABI 7500, 7700, 7900 or the Roche LightCycler 480. Use an appropriate instrument-specific Fuorophore/Quencher combination.  The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

CGTCACTAAATTGGTGGCAAatcttccaaaagactacatgataaccctca
aatatgtccccgggatggatgttttgccaagtcattgttggataagcgag
atggtagtacaattgtcagacagcttgactgatcttctggacaagttttc
aaatatttctgaaggcttgagtaattattccatcatagacaaacttgtga
atatagtggatgaccttgtggagtgcgtgaaagaaaactcatctaaggat
ctaaaaaaatcattcaagagcccagaacccaggctctttactcctgaaga
attctttagaatttttaatagatccattgatgccttcaaggactttgtag
tggcatctgaaactagtgattgtgtggtttcttcaacattaagtcctgag
aaagattccagagtcagtgtcacaaaaccatttatgttaccccctgttgc
agccagctcccttaggaatgacagcagtagcagtaATAGGAAGGCCAAAA
ATCCC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
8985 CAA GGA CTT TGT AGT GGC ATC TG Transgene Forward A
8988 CAA CAG GGG GTA ACA TAA ATG G Transgene Reverse A
8989 Fluorophore-1 CCT GAG AAA GAT TCC AGA GTC AGT GTC ACA Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
8985 0.40 uM
8988 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Tg Probe 0.15 uM
IC Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
035844 NOD.Cg-Flt3em1Akp Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav Tg(HLA-A/H2-D/B2M)1Dvs/J
035843 NOD.Cg-Flt3em1Akp Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/J
032474 NOD.Cg-Prkdcscid Abcd1em2Lutzy Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ
037320 NOD.Cg-Prkdcscid H2-K1b-tm1Bpe H2-Ab1g7-em1Mvw H2-D1b-tm1Bpe Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav Tg(IL15)1Sz/J
028657 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav Tg(CSF1)3Sz/J
013062 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ
024099 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/J
7 strains use this protocol