For in-depth product & services help, ask our
Technical Information Scientists
Notes
This assay DOES distinguish hemizygous from homozygous transgenic animals. Specific hemizygous and homozygous controls should be used.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Homozygote = 300 bp
Hemizygote = 300 bp and 400 bp
Noncarrier (wild type) = 400 bp
The integration site of this Tg is known to be on Mouse Chr 6 so this assay can distinguish hemi from hom.
Separated by gel electrophoresis on a 1.5% agarose gel.
Sequence
Mutant sequence
GGTCTGTTCTACAGCCACAGCTGTACCTACGTTCAGAAGACAGACAAAAGTTGCTGTGTTTGAAGAGATCCTTCATTAAGGGATCAGACAGAGATTACTTTGAGACAATTTGGGAGGCTACATATTTCTGGTTTCTTAAACAAAAACTCATTTTTCAAAGATTCTGGAGCTTTGGTTTGTTTTCAGAATTTATACAGTGTTAAAAGTTAACTTATCAGTTCATACAGCACACAGAAGCTATGACACTGAGTTGGAAAAATTTCCCCTAATGCCTCATCCCTGGTAGGTCAG
Yellow highlight: primer
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| oIMR5065 | CTG ACC TAC CAG GGA TGA GG | Common | A | |||
| oIMR5066 | GGT CTG TTC TAC AGC CAC AGC | Transgene | A | |||
| oIMR5067 | CCC AGG TGG TTT ATA GAC TCA GA | Wild type | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| oIMR5065 | 0.50 uM |
| oIMR5066 | 0.50 uM |
| oIMR5067 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 008209 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)69Ahmb/J |
| 005026 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J |
| 005025 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J |
| 005024 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J |
| 008203 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)63Ahmb/J |
| 006570 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj/J |
| 008212 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-SMN)92Ahmb/J |
| 025102 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch/DaschMmjax |
| 008783 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(CAG-cre/Esr1*)5Amc Tg(SMN2*delta7)4299Ahmb/J |
| 007951 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(SMN2*delta7)4299Ahmb/J |
| 10 strains use this protocol | |