For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:101643014-101643119 106bp CGACTCTGCTTTGGTGTCTG CACCACTGTGAAGGGACCA
Mutant= 110 bp
Wild Type = 106 bp
Sequence
Wt Sequence: CGACTCTGCTTTGGTGTCTGCTTTGATGGACATGGAAGAAGACATCTTGGAAGGCATGAGATCCCAAgatcttgatgactacctgaatggtcccttcacagtggtg
Mutant Sequence: ctaaagcgcatgctccagactgccttgggaaaagcgcctcccctacccggtagaattcctgcagcccggggGATCTTGATGACTACCTGAATGGTCCCTTCACAGTGGTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35458 | Fluorophore-1 | CAT CTT GGA AGG CAT GAG ATC | Quencher-1 | WT Probe | ||
| 35459 | CGA CTC TGC TTT GGT GTC TG | Wild type Forward | A | |||
| 35460 | CAC CAC TGT GAA GGG ACC A | Common | A | |||
| 35461 | Fluorophore-2 | TGG GAA AAG CGC CTC C | Quencher-2 | MUT Probe | ||
| oIMR5316 | CTA AAG CGC ATG CTC CAG AC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35459 | 0.40 uM |
| 35460 | 0.40 uM |
| oIMR5316 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 032088 | B6.129S-Rag1tm1Mom Cd47tm1Fpl Il2rgtm1Wjl/SzJ |
| 003174 | B6.129S4-Il2rgtm1Wjl/J |
| 032562 | FVB.129S7(B6)-Rag1tm1Mom/LcsnJ |
| 018454 | NOD.Cg-Rag1tm1Mom Fahem1Mvw Il2rgtm1Wjl/MvwJ |
| 033127 | NOD.Cg-Rag1tm1Mom Flt3tm1Irl Mcph1Tg(HLA-A2.1)1Enge Il2rgtm1Wjl/J |
| 035855 | NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(HLA-A/H2-D/B2M)Dvs Tg(HLA-DRA,HLA-DRB1*0401)39-2Kito/J |
| 030533 | NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(SLC10A1)15Mvw/MvwJ |
| 026014 | NOD.Cg-Rag1tm1Mom KitW-41J Il2rgtm1Wjl/EavJ |
| 017914 | NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(HLA-DRA,HLA-DRB1*0401)39-2Kito/ScasJ |
| 007799 | NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/SzJ |
| 014568 | NOD.Cg-Rag1tm1Mom Ins2Akita Il2rgtm1Wjl/SzJ |
| 006303 | NOD.FVB-Tg(TcraBDC12-4.1)10Jos/GseJ |
| 006770 | STOCK Rag1tm1Mom Tg(TIE2GFP)287Sato/J |
| 13 strains use this protocol | |