For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 79 bp
Wild Type = 94 bp
>chr5:108819412+108819505 94bp TGTGGCCTCAAAGATACATCC GGATCAATACAAACCTGCACAAC
Sequence
Wt Sequence: ctacccatgtcctacagcccctctccaaggtttataGTcactctgtggcctcaaagatacatcctTGgtggcacatcatgtctactactgttatgatgattctgtgacctgcaggttgtgcaggtttgtattgatcccagactgagggaaaaggagtaaccgtcaaagtcagcaaaatccatatttccaccagtggcatcaggacactctgcatcgccaaggacagaata
Mut Sequence:
TTATAGTCACTCTGTGGCCTCAAAGATACATCCTTtgaaagacccccgaggtgggtagtcaatcaatctgaggagaccctcccaaggatcagcgagaccacgattcggatgtaaacagcaagaggctttattgggaacacgggtacccgggcgactcagtctgtcggaggactggcgcgccgagtgtggggtttttaccctttttatagggctggggagcaaaaagcgt
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36815 | TGT GGC CTC AAA GAT ACA TCC | Common | A | |||
| 36816 | TGA TCC TTG GGA GGG TCT C | Mutant Reverse | A | |||
| 36817 | GGA TCA ATA CAA ACC TGC ACA AC | Wild type Reverse | A | |||
| 36818 | Fluorophore-1 | ACC CCC GAG GTG GGT AGT CA | Quencher-1 | MUT Probe | ||
| 36819 | Fluorophore-2 | TGG CAC ATC ATG TCT ACT ACT GTT ATG A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36815 | 0.40 uM |
| 36816 | 0.40 uM |
| 36817 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 037206 | B6.129-Optntm1.1Htse/J |
| 004202 | B6.C3 Pde6brd1 Hps4le/+ +-Lmx1adr-8J/J |
| 000002 | B6.C3-Pde6brd1 Hps4le/J |
| 006576 | B6.FVB-Tg(GNAT2-Dta)98Wwk/J |
| 004462 | B6;C3-Tg(APPswe,PSEN1dE9)85Dbo/Mmjax |
| 028590 | B6C3-Tg(tetO/Prnp-TARDBP*)2Vle/J |
| 002810 | B6CBA-Tg(HDexon1)62Gpb/1J |
| 006494 | B6CBA-Tg(HDexon1)62Gpb/3J |
| 001924 | B6EiC3Sn a/A-Ts(1716)65Dn/J |
| 004850 | B6EiC3Sn-Rb(12.Ts171665Dn)2Cje/CjeDnJ |
| 006554 | B6SJL-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax |
| 001957 | C3A Pde6brd1.O20/A-Prph2Rd2/J |
| 001979 | C3A.Cg-Pde6b+ Prph2Rd2/J |
| 024703 | C3A.Cg-Pde6b+Tg(Thy1-CFP)23Jrs/SjJ |
| 003648 | C3Sn.BLiA-Pde6b+/DnJ |
| 000654 | CBA/CaJ |
| 000656 | CBA/J |
| 004624 | FVB.129P2-Pde6b+ Tyrc-ch Fmr1tm1Cgr/J |
| 004828 | FVB.129P2-Pde6b+ Tyrc-ch/AntJ |
| 022880 | FVB.Cg-Pde6b+ Lrrk1tm1.1Mjff Tyrc-ch/J |
| 003342 | STOCK Hbatm1Paz Hbbtm1Tow Tg(HBA-HBBs)41Paz/J |
| 013169 | STOCK Nphp1tm1Jgg/J |
| 005441 | STOCK Tg(CAG-DsRed*MST)1Nagy/J |
| 004808 | STOCK Tg(MAPT)8cPdav Mapttm1(EGFP)Klt/J |
| 010815 | STOCK Tg(mI56i-flpe)39Fsh/J |
| 25 strains use this protocol | |