Stock No: 003771
Protocol 31758: Standard PCR Assay - Tg(Nes-cre)1Kln-Chr12
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 150 bp
Heterozygote = 150 bp and 246 bp
Wild type = 246 bp

>chr12:91762886+91763131 246bp TTGCTAAAGCGCTACATAGGA GCCTTATTGTGGAAGGACTG   
 
This assay is capable of distinguishing hemi from hom.  Transgene integration site is known to be on mouse Chr 12.
This assay is NOT able to be used for transgene copy number evaluation.  If this is required, it is suggested to type by qPCR.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37567 TTG CTA AAG CGC TAC ATA GGA Wild type Forward A mChr12
37568 GCC TTA TTG TGG AAG GAC TG Common A mChr12
37569 CCT TCC TGA AGC AGT AGA GCA Transgene Forward A hGH1

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
37567 0.50 uM
37568 0.50 uM
37569 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.