For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 142 bp
Heterozygote = 142 bp and 265 bp
Wild type = 265 bp
>chr9:112912299+112912563 265bp GTGTGATCCATTCCATCAGC GGATCTCTGAGGGGTCCAGT
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 9.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42431 | GTG TGA TCC ATT CCA TCA GC | Wild type Forward | A | |||
| 42432 | GGA TCT CTG AGG GGT CCA GT | Common | A | |||
| 42433 | ATG GTA GAG TAA GCG AGA ACA CG | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 42431 | 0.50 uM |
| 42432 | 0.50 uM |
| 42433 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.