Protocol 34912: Separated PCR Assay - Gt(ROSA)26Sor<CAG-DR>

STOCK Gt(ROSA)26Sor^{tm2(CAG-APX1*)Ddg}/J

Stock No: 032767

Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:113075919-113076111 193bp CTGGCTTCTGAGGACCG AATCTGTGGGAAGTCTTGTCC

Mutant = 161 bp
Heterozygote = 161 bp and 191 bp
Wild type = 191 bp

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction	Note
21306		CTG GCT TCT GAG GAC CG		Wild type Forward	A
21309		AAT CTG TGG GAA GTC TTG TCC		Wild type Reverse	A
44788		GTT CGG GTG AAG GCC CAG		Mutant Forward	B
44789		TCT GCA AGC TTT CAT TTA TTC ATC G		Mutant Reverse	B

Reaction A

Component	Final Concentration
ddH2O
Kapa 2G HS buffer	1.30 X
MgCl2	2.60 mM
dNTPS-kapa	0.26 mM
21306	0.50 uM
21309	0.50 uM
Glycerol	6.50 %
Dye	1.00 X
Kapa 2G HS taq polym	0.03 U/ul
DNA

Cycling

Step	Temp °C	Time	Note
1	94.0	--
2	94.0	--
3	65.0	--	-0.5 C per cycle decrease
4	68.0	--
5		--	repeat steps 2-4 for 10 cycles (Touchdown)
6	94.0	--
7	60.0	--
8	72.0	--
9		--	repeat steps 6-8 for 28 cycles
10	72.0	--
11	10.0	--	hold

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component	Final Concentration
ddH2O
Kapa 2G HS buffer	1.30 X
MgCl2	2.60 mM
dNTPS-kapa	0.26 mM
44788	0.50 uM
44789	0.50 uM
Glycerol	6.50 %
Dye	1.00 X
Kapa 2G HS taq polym	0.03 U/ul
DNA

Cycling

Step	Temp °C	Time	Note
1	94.0	--
2	94.0	--
3	65.0	--	-0.5 C per cycle decrease
4	68.0	--
5		--	repeat steps 2-4 for 10 cycles (Touchdown)
6	94.0	--
7	60.0	--
8	72.0	--
9		--	repeat steps 6-8 for 28 cycles
10	72.0	--
11	10.0	--	hold

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number	Strain Name
032764	STOCK Gt(ROSA)26Sor^tm1(CAG-COX4I1/APX1*)Ddg/J
032767	STOCK Gt(ROSA)26Sor^tm2(CAG-APX1*)Ddg/J
034748	STOCK Gt(ROSA)26Sor^tm3(CAG-HRP)Ddg/J
034749	STOCK Gt(ROSA)26Sor^tm4(CAG-HRP)Ddg/J
4 strains use this protocol