Stock No: 033403
Protocol 36384: Probe Assay - Il2rg<em#(delEx3)Lutzy>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  110 bp

Wild Type = 77 bp

X-linked

>chrX:101267366-101267442 77bp CCAAAGAGATTACTTCTGGCTGT CTGGAGCTGGACAACAAATG

Sequence

Wt Sequence (deletions in lower case):
GGGTAGCCAGCTCTTCAGGAACCCTACCAGTTTCTCATGGGATGCATTGTCAGTTCAGACCAGATGaggctagctaatgggcatatgcatgcccatgtttggcccatcattcttttgccttgtaacccttctctaggtacaaggtatctgataataatacattccaggagtgcagtcactatttgttctccaaagagattacttctggctgtcagatacaaaaagaagatatccagctctaccagacatttgttgtccagctccaggacccccagaaaccccagaggcgagctgtacagaagctaaacctacagaatcttggtaatcgggaaagaagtagccaagagagcagggagcttaaagacactggagtttatagattgttggccatgggCAGAAAAGAGAAGATAGGGGGGTTGGGATGGGGAAGGGAGGAGGGATAAGGGGAATTACCTCC

328 bp deletion

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48598 CCA AAG AGA TTA CTT CTG GCT GT Wild type Forward A
48599 CTG GAG CTG GAC AAC AAA TG Wild type Reverse A
48600 Fluorophore-1 AGA TAC AAA AAG AAG ATA TCC AGC TCT AC Quencher-1 WT Probe
48601 AGC TCT TCA GGA ACC CTA CCA Mutant Forward A
48602 CCC TTA TCC CTC CTC CCT TC Mutant Reverse A
48603 Fluorophore-2 CAG ACC AGA TGC AGA AAA GAG AAG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
48598 0.40 uM
48599 0.40 uM
48601 0.40 uM
48602 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.