For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:104188843+104189134 292bp GCTCATCCCCAATTTCTTGA GTTGTTGCCTGTCCCAGACT
Mutant = 163 bp
Heterozygote = 163 bp and 292 bp
Wild type = 292 bp
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49779 | GCT CAT CCC CAA TTT CTT GA | Wild type Forward | A | Wt F | ||
| 49780 | GTT GTT GCC TGT CCC AGA CT | Wild type Reverse | A | Wt R | ||
| 49781 | CGC AGA TGT TGC AGT AGG AA | Mutant Forward | A | Mut F | ||
| 49782 | TCG GAG CTG AAC AGG ATA CA | Mutant Reverse | A | Mut R |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 49779 | 0.50 uM |
| 49780 | 0.50 uM |
| 49781 | 0.50 uM |
| 49782 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 038105 | B6(Cg)-Apoetm1.1(APOE*4)Adiuj Tc(HSA17)1Mdk Appem2Aduci/AduciJ |
| 038104 | B6(Cg)-Apoetm1.1(APOE*4)Adiuj Tc(HSA17)1Mdk Apptm1.1Aduci/AduciJ |
| 036664 | B6(Cg)-Tc(HSA17*)1Mdk/J |
| 038908 | B6.Cg-Tc(HSA17)2Mdk Appem1Adiuj/J |
| 039175 | B6J.B6N(CBA)-Tc(HSA17)1Mdk Psen1tm1.1(PSEN1)Mdk Apptm1.1(APP)Mdk/J |
| 033668 | B6J.B6N(CBA)-Tc(HSA17)1Mdk/J |
| 035794 | B6J.B6N(Cg)-Tc(HSA17*N279K)1Mdk/J |
| 035398 | B6J.B6N-Tc(HSA17)2Mdk/J |
| 037420 | B6J.B6N-Tc(HSA17*P301L)1Mdk/J |
| 9 strains use this protocol | |