Protocol 37103: Separated PCR Assay - A<w-J> A<y> A<w> Alternate2

C57BL/6J

Stock No: 000664

Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

HET = 268 bp and 763 or 162 bp
MUT A = 763 bp and 162 bp in agouti (A) allele

WT nonagouti (a) = 268 bp

>chr2:155017745+155018012 268bp AGTCCCACAGAGACGAGACC GAGGGGACTATAATTCAGCTTTTAC

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction	Note
50528		AGT CCC ACA GAG ACG AGA CC		Wild type Forward	A
50529		GAG GGG ACT ATA ATT CAG CTT TTA C		Wild type Reverse	A
oIMR7876		GGC CAC ACT TAG GGA GTT CA		Mutant Forward	B
oIMR7932		GGT TGG CCA CCA TGT CTA GT		Mutant Reverse	B

Reaction A

Component	Final Concentration
ddH2O
Kapa 2G HS buffer	1.30 X
MgCl2	2.60 mM
dNTPS-kapa	0.26 mM
50528	0.50 uM
50529	0.50 uM
Glycerol	6.50 %
Dye	1.00 X
Kapa 2G HS taq polym	0.03 U/ul
DNA

Cycling

Step	Temp °C	Time	Note
1	94.0	--
2	94.0	--
3	65.0	--	-0.5 C per cycle decrease
4	68.0	--
5		--	repeat steps 2-4 for 10 cycles (Touchdown)
6	94.0	--
7	60.0	--
8	72.0	--
9		--	repeat steps 6-8 for 28 cycles
10	72.0	--
11	10.0	--	hold

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component	Final Concentration
ddH2O
Kapa 2G HS buffer	1.30 X
MgCl2	2.60 mM
dNTPS-kapa	0.26 mM
oIMR7876	0.50 uM
oIMR7932	0.50 uM
Glycerol	6.50 %
Dye	1.00 X
Kapa 2G HS taq polym	0.03 U/ul
DNA

Cycling

Step	Temp °C	Time	Note
1	94.0	--
2	94.0	--
3	65.0	--	-0.5 C per cycle decrease
4	68.0	--
5		--	repeat steps 2-4 for 10 cycles (Touchdown)
6	94.0	--
7	60.0	--
8	72.0	--
9		--	repeat steps 6-8 for 28 cycles
10	72.0	--
11	10.0	--	hold

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number	Strain Name
000202	AEJ/Gn-bd/J
000199	AEJ/GnLeJ
000427	B10.CE-H13^b A^w/(30NX)SnJ
000420	B10.LP-H13^b A^w/Sn
000593	B6 x B6CBCa A^w-J/A-Grid2^Lc T(2;6)7Ca Mitf^Mi-wh/J
000502	B6 x B6CBCa A^w-J/A-Myo5a^flr Gnb5^flr/J
000599	B6 x B6CBCa A^w-J/A-T(5;13)264Ca Kit^W-v/J
002016	B6(Cg)-A^w-J Eda^Ta-6J Chr Y^B6-Sxr/EiJ
000600	B6-Gpi1^b x B6CBCa A^w-J/A-T(7;15)9H Gpi1^a/J
001809	B6.Cg-A^w-J Eda^Ta-6J +/+ Ar^Tfm/J
000552	B6.Cg-A^w-J Eda^Ta-6J Sxr
001730	B6.Cg-A^w-J Eda^Ta-6J Sxr^b Hya^-/J
000841	B6.Cg-A^w-J Eda^Ta-By/J
005505	B6.Cg-A^y Slc7a11^sut/LmLlp
000021	B6.Cg-A^y/J
004200	B6;CBACa A^w-J/A-Npr2^cn-2J/GrsrJ
100409	B6129PF1/J-A^w-J/A^w
000505	B6C3 A^w-J/A-Bloc1s5^mu/J
000314	B6CBACa A^w-J/A-Eda^Ta/J-XO
000288	B6CBACa A^w-J/A-Tgm3^we a Mafb^kr/J
000501	B6CBACa A^w-J/A-Aifm1^Hq/J
001046	B6CBACa A^w-J/A-Grid2^Lc/J
000500	B6CBACa A^w-J/A-Gs/J
002703	B6CBACa A^w-J/A-Hydin^hy3/J
000247	B6CBACa A^w-J/A-Kcnj6^wv/J
000287	B6CBACa A^w-J/A-Plp1^jp Eda^Ta/J
000515	B6CBACa A^w-J/A-Sfn^Er/J
000242	B6CBACa A^w-J/A-spc/J
001201	B6CBACaF1/J-A^w-J/A
002343	B6EiC3Sn a/A-Otc^spf/J
000638	C3FeB6 A/A^w-J-Sptbn4^qv-J/J
000200	C3FeB6 A/A^w-J-Ank^ank/J
001203	C3FeB6F1/J A/A^w-J
000664	C57BL/6J
000338	C57BL/6J A^w-J-Eda^Ta-6J/J
000569	C57BL/6J-A^w-J-Eda^Ta +/+ Ar^Tfm/J
000051	C57BL/6J-A^w-J/J
002468	KK.Cg-A^y/J
000064	STOCK a Tyrp1^b Pmel^si/J
001432	STOCK a/a Tyrp1^b Ndc1^sks/Tyrp1^b +/J
001427	STOCK A^w us/J
001752	STOCK T(7;15)9H/J
42 strains use this protocol