Protocol 37868: Probe Assay - Mapt<tm1(EGFP)Klt>-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:104282410+104282510 101bp AATGGAAGACCATGCTGGAG TGGCCAGTTGTGTATGTCCA

Mut= 93 bp

Wt= 101 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence:

TCGCCAGGAGTTTGACACAATGGAAGACCATGCTGGAGATTACACTCTGCTCCAAGACCAAGAAGGAGACATGGACCATGGCTTAAAAGgtcagtggggtggacatacacaactggccagtcacagtg

Mutant Sequence:

ACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAAC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
12390 GTC TTG TAG TTG CCG TCG TC Mutant Reverse A
39873 TGG CCA GTT GTG TAT GTC CA Wild type Reverse A
52360 CAT GAA GCA GCA CGA CTT CT Mutant Forward A
52361 Fluorophore-1 AAG GAG ACA TGG ACC ATG GCT Quencher-1 WT Probe
52362 Fluorophore-2 CGA AGG CTA CGT CCA GGA GC Quencher-2 MUT Probe
oIMR7824 AAT GGA AGA CCA TGC TGG AG Wild type Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
12390 0.40 uM
39873 0.40 uM
52360 0.40 uM
oIMR7824 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
029219 B6.129S4(Cg)-Mapttm1(EGFP)Klt/J
005491 B6.Cg-Tg(MAPT)8cPdav Mapttm1(EGFP)Klt/J
004779 STOCK Mapttm1(EGFP)Klt/J
004808 STOCK Tg(MAPT)8cPdav Mapttm1(EGFP)Klt/J
4 strains use this protocol
For in-depth product & services help, ask our Technical Information Scientists