Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr6:111099925+111100076 152bp CAAACCAAAGCTCCAGAATC GTGGCCAAATGTCAGTCACC
Mut= 158 bp
Wt= 152 bp
Fam=Mut
Hex=Wt
Wt Sequence:
tctacattactgacctaccagggatgaggcattaggggaaatttttccaactcagtgtcatagcttctgtgtgctgtatgaactgataagttaacttttaacactgtataaattctgaaaacaaaccaaagctccagaatctttgaaaaatgagtttttgtttaagaaaccagaaatatgtagcctcccaaattgtcTGtaccctctgagttctcaattatttttaagtgtctgtgctacttagaggtggccaggtgactgacatttggccactatgaaggaagaaac
Mutant Sequence:
GTATAAATTCTGAAAACAAACCAAAGCTCCAGAATCTTTGAAAAATGAGTTTTTGTTTAAGAAACCAGAAATATGTAGCCTCCCAAATTgtctCAAAGTAATCTCTGTCTGATCCCTTAATGAAGGATCTCTTCAAACACAGCAACTTTTGTCTGTCTTCTGAACGTAGGTACAGCTGTGGCTG
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
52364 | CAA ACC AAA GCT CCA GAA TC | Common | A | |||
52365 | GTG GCC AAA TGT CAG TCA CC | Wild type Reverse | A | |||
52366 | TGT ACC TAC GTT CAG AAG ACA GAC | Mutant Reverse | A | |||
52367 | Fluorophore-1 | CCC AAA TTG TCT GTA CCC TCT GAG | Quencher-1 | WT Probe | ||
52368 | Fluorophore-2 | CCC TTA ATG AAG GAT CTC TTC AAA CAC | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
52364 | 0.40 uM |
52365 | 0.40 uM |
52366 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
Stock Number | Strain Name |
---|---|
007222 | B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J |
006964 | B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J |
006773 | B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J |
006385 | B6;129P2-Syt1tm3Sud/J |
006386 | B6;129P2-Syt1tm5Sud/J |
008209 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)69Ahmb/J |
007968 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/2J |
005026 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J |
007952 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/2J |
005025 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J |
031906 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2-SMN1*T274I)5Ahmb/J |
007949 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/2J |
005024 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J |
030214 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-PLS3)14Ahmb Tg(SMN2*delta7)4299Ahmb/J |
030970 | FVB.Cg-Mapk10tm1Flv Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/LganJ |
031907 | STOCK Grm7Tg(SMN2)89Ahmb Tg(SMN2-SMN1*Q282A)2Ahmb Smn1tm1Msd/J |
008203 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)63Ahmb/J |
032003 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj Tg(SMN2*delta7)4299Ahmb/J |
006570 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj/J |
008212 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-SMN)92Ahmb/J |
025102 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch/DaschMmjax |
018916 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1-SMN2*)16Cll/CllJ |
031908 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2-SMN1*D44V)10Ahmb/J |
008783 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(CAG-cre/Esr1*)5Amc Tg(SMN2*delta7)4299Ahmb/J |
007951 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(SMN2*delta7)4299Ahmb/J |
007022 | STOCK Mnx1tm4(cre)Tmj Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J |
017600 | STOCK Tg(tetO-SMN2,-luc)#bAhmb/J |
27 strains use this protocol |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.