For in-depth product & services help, ask our
Technical Information Scientists
Notes
Homozygous Mutant = C/C (SJL/J)
Heterozygote = A/C
Wild type = A/A (C57BL6/J)
>chr2:99216856+99217140 285bp TGTTGGAACTTTGTGCTTGG AACAGATGTCAAATAGGACAACAC
This assay detects a SNP between C57BL6/J and SJL/J, located approximately 4.7 kb from the transgene integration site. It is capable of detecting all genotypes.
Please refer to notes within the protocol called Tg(K18-ACE2)2Prlmn-Chr2 for a complete description.
In lieu of Sanger sequencing, a HpyCH4V cut site is created by this SNP in SJL/J. Two products of 148 bp and 137 bp are present after amplification with these primers followed by restriction digest.
The Tg(K18-ACE2)2Prlmn transgene was generated by injection of (B6J x SJL)F2 blastocysts. This additional Chr2_rs13476660-SEQ assay is designed to detect a SNP present between C57BL/6J and SJL/J. This SNP maps to the duplicated region of Chr 2 linked to the (K18-ACE2)2Prlmn transgene. Therefore, this assay provides surrogate zygosity information and is capable of distinguishing hemi from hom.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
ACTGGCCATGTTTGTGGTCATCTCACTAGGCCCACAAGCTTATTTCAGTAGTATTCTACTCCTTCTTAGGCATCTCTTACCAGACAAGTATTATCATTTAGCATTTG(a/c)AAAGCAGTTATTTTCCAGGGTTTTTTTGACAGAAGTGTGCGAAAAATAAGGCAAGCTACATGTAGAAACTGTTTATACCATCTTTTTTCTTATTCCCATTTTTAGAGGATAGATGTGTTGTCCTAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53435 | TGT TGG AAC TTT GTG CTT GG | Forward | A | |||
| 53436 | AAC AGA TGT CAA ATA GGA CAA CAC | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 53435 | 0.50 uM |
| 53436 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.