For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Heterozygote = 170 bp and 221 bp
Wild type = 221 bp
>chr2:99209347-99209567 221bp CACCAACACAGTTTCCCAAC AAGTTGGAGAAGATGCTGAAAGA
In May 2020, analysis commissioned by The Jackson Laboratory determined that multiple copies of the Tg(K18‐ACE2)2Prlmn transgene integrated at a single site on chromosome 2 (99,209,508‐99,220,724; mouse mm10). An ~11 kb duplication of the host genome (chr2:99,209,508‐99,220,724) is present at both ends of the integrated transgene array.
Currently, there are no genes annotated in this region. The transgene copy number of the hemizygous mouse is estimated to be 8 full copies (or 12‐30 partial copies).
This assay is designed around this integration site, but the large duplication of the mouse genome, present at both ends of the integrated vector sequence, make this assay incapable of distinguishing hemi from hom.
This transgene was generated by injection of (B6J x SJL)F2 blastocysts. The additional Chr2_rs13476660-SEQ assay is designed to detect a SNP present between C57BL/6J and SJL/J. This SNP maps to the duplicated region of Chr 2 linked to the (K18-ACE2)2Prlmn transgene. Therefore, this assay provides surrogate zygosity information and is capable of distinguishing hemi from hom.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53437 | GAC CCC TGA GGG TTT CAT ATA G | Transgene Forward | B | hKRT18flank | ||
| 53438 | CAC CAA CAC AGT TTC CCA AC | Common | A, B | mChr2 | ||
| 53439 | AAG TTG GAG AAG ATG CTG AAA GA | Wild type Forward | A | mChr2 |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 53438 | 0.50 uM |
| 53439 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Reaction B
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 53437 | 0.50 uM |
| 53438 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.