For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 107 bp
Wild Type = 82 bp
>chr2:101643577-101643658 82bp AAAGAGACTTTGGTGCATATCAA GATGTTTCTGCGCCCTTCTC
The Mut probe (primer 54171) anneals over the nucleotide sequence containing mouse genomic variations rs27362105.
Sequence
Wt Sequence (with deletion in brackets):
GTGGAAAGGGAATTAAATTTCACATATACATGTATTTAAAATCATGCATATATTTAGTATAAGTGTCCCCAAAT[attgtcaggaaaggattggccattttggctgtatgatcagcacccaacagagaatattaaaataggagatttaataaatattgttggaaagaattaaatgaatgaaaaactgagggcatcaatcagttatttccaaaatattgcgatacgctattgatacttttcttttttgtttttgtttgcttgtttgattcttttcttaacttgactcccccccccccccccattgttcccaggtagcttagccaacatggctgcctccttgccgtctaccctgagcttcagttctgcacccgatgaaattcaac……..cggggcctgggcaagtgagggaaatgaatcgggtaacaagctgtttagacggtttcggaaaatgaatgccaggcagtccaagtgctatgagatggaagatgtcctgaaacatcactggctgtatacttcaaaatacctccagaagtttatgaatgctcataacgcgttaaaaagctctgggtttaccatgaactcaaaggagaccttaggggaccctttgggcattgaggactctctggaaagccaagattcaatggagttttaaataggatctccacatagaagttggtatttgccaatgtgttttcctttgggttgcagtgaggtcttctcctagcacctagcacattgccatgtgggtgggtcttatcacccaaggggtgacatgttggagtgagaggccagaggtgctgtcacct]GGTCAGGGATCGATAGTTGACAAGATGAGATTGCCTGAGCCGTTTAGTGAGGCCAGAAGAGCAACAGGAGAAATCAGTT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53511 | AAA GAG ACT TTG GTG CAT ATC AA | Wild type Forward | A | |||
| 53512 | GAT GTT TCT GCG CCC TTC TC | Wild type Reverse | A | |||
| 53513 | Fluorophore-1 | CTC GCC AGC ATC TCC TGT C | Quencher-1 | WT Probe | ||
| 53514 | AAA GGG AAT TAA ATT TCA CAT ATA CA | Mutant Forward | A | |||
| 53515 | CAG GCA ATC TCA TCT TGT CA | Mutant Reverse | A | |||
| 54171 | Fluorophore-2 | CCC AAA TGG TCA GGG ATC GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53511 | 0.40 uM |
| 53512 | 0.40 uM |
| 53514 | 0.40 uM |
| 53515 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.