For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 289 bp
Heterozygote = 231 bp and 289 bp
Wild type = 231 bp
>chr7:4564358-4564588 231bp AGTGGGCTCTTCTACCCACA GGATCCATCCATCAAAGGTG
This assay is capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 7.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43224 | GGC GTT ACT ATG GGA ACA TAC G | Mutant Forward | B | CMV enhancer | ||
| 57313 | AGT GGG CTC TTC TAC CCA CA | Wild type Forward | A | mChr7 | ||
| 57314 | GGA TCC ATC CAT CAA AGG TG | Common | A, B | mChr7 |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 57313 | 0.50 uM |
| 57314 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Reaction B
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 43224 | 0.50 uM |
| 57314 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 025854 | B6;FVB-Ptprca Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J |
| 010545 | C.FVB-Tg(CAG-luc,-GFP)L2G85Chco/FathJ |
| 010548 | D1.FVB(Cg)-Tg(CAG-luc,-GFP)L2G85Chco/FathJ |
| 008450 | FVB-Tg(CAG-luc,-GFP)L2G85Chco/J |
| 010542 | NOD.FVB-Tg(CAG-luc,-GFP)L2G85Chco/FathJ |
| 025855 | STOCK Ptprca Lag3tm1Doi Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J |
| 6 strains use this protocol | |