For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:104265226+104265523 298bp TTCTTAACCGCTGAGCCATC CCTTTGGGATTTTAACCATGTG
Mutant = 382 bp (strains 33668 H2)
Heterozygote = 382 bp (strains 33668 H2) and 298 bp
Wild type = 298 bp
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49773 | TTC TTA ACC GCT GAG CCA TC | Wild type Forward | A | |||
| 49774 | CCT TTG GGA TTT TAA CCA TGT G | Wild type Reverse | A | |||
| 57519 | CGG CAC ATT CCC AGA GAA CT | Mutant Forward | B | |||
| 57520 | CCT AGA GGA AAG GTC ACC G | Mutant Reverse | B |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 49773 | 0.50 uM |
| 49774 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Reaction B
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 57519 | 0.50 uM |
| 57520 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 038105 | B6(Cg)-Apoetm1.1(APOE*4)Adiuj Tc(HSA17)1Mdk Appem2Aduci/AduciJ |
| 038104 | B6(Cg)-Apoetm1.1(APOE*4)Adiuj Tc(HSA17)1Mdk Apptm1.1Aduci/AduciJ |
| 036664 | B6(Cg)-Tc(HSA17*)1Mdk/J |
| 039175 | B6J.B6N(CBA)-Tc(HSA17)1Mdk Psen1tm1.1(PSEN1)Mdk Apptm1.1(APP)Mdk/J |
| 033668 | B6J.B6N(CBA)-Tc(HSA17)1Mdk/J |
| 035794 | B6J.B6N(Cg)-Tc(HSA17*N279K)1Mdk/J |
| 6 strains use this protocol | |