Stock No: 029017
Protocol 43307: Probe Assay - Apoe<em#(APOE*4)> 3 prime T corrected alt 1
Version 2.0

Notes

This assay cannot distinguish hemi from hom

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

TG= 107 bp

IPC= 74 bp

 

Sequence

CTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAG(c/t)GCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCG

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39412 CTG CGT AAG CGG CTC CT Mutant Forward B
39413 TCG CGG ATG GCG CTG AG Mutant Reverse B
62727 Fluorophore-1 TGC AGA AGT GCC TGG CA Quencher-1 MUT Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
oIMR1544 0.40 uM
oIMR3580 0.40 uM
IC Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Reaction B

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39412 0.40 uM
39413 0.40 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.