Protocol 31172: Probe Assay - Generic SV40 TAg 1 Probe
Version 1.0

Notes

This assay cannot distinguish hemi from hom

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Tg=  72 bp

IPC = 74 bp

Sequence

Tg Sequence:

  gggcctgaaatgagccttgggactgtgaatcaatgcctgtttcatgccctgagtcttccatgttcttctccccaccatcttcatttttatcagcattttcc

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
36312 GAG CCT TGG GAC TGT GAA TC Transgene Forward A
36313 TGA AGA TGG TGG GGA GAA GA Transgene Reverse A
36314 Fluorophore-1 TGC CTG TTT CAT GCC CTG AGT C Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
36312 0.40 uM
36313 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
036602 B10.Cg-H2k2 H2-T18a Tg(SV40-HA)HA104Ajca/VradMmjax
010575 B6;SJL-Tg(tetO-Egfr*)2-9Jek/J
002233 C57BL/6J-Tg(SV)7Bri/J
013591 FVB-Tg(C3-1-TAg)cJeg/JegJ
030386 FVB/N-Tg(C3-1-TAg)cJeg/2JegJ
5 strains use this protocol