Protocol 33132 - Kif1a<em2/3(I304I,P305L)Lutzy>

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant= x bp

Wild Type = y bp

Sequence

Wt Sequence (bp changes in brackets with wt first):

TGTGTCCCCACAGAACAAGAAAAAGAAGAAGACAGATTTCAT(c/a)C(c/t)TTACCGAGACTCCGTATTGACATGGCTTCTCCGGGAAAACCTCGGTAAGCATG

I304I, P305L

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction
39579		TGT GTC CCC ACA GAA CAA GA		Forward	A
39581	Fluorophore-1	TCA TCC CTT ACC GAG ACT CC	Quencher-1	WT Probe
40728		CAT GCT TAC CGA GGT TTT CC		Reverse	A
40729	Fluorophore-2	CAG ATT TCA TAC TTT ACC GAG ACT CC	Quencher-2	MUT Probe

Reaction A

Component	Final Concentration
Kapa Probe Fast QPCR	1.00 X
ddH2O
39579	0.40 uM
40728	0.40 uM
Wt Probe	0.15 uM
Mutant Probe	0.15 uM
DNA

Cycling

Step	Temp °C	Time	Note
1	95.0	--
2	95.0	--
3	60.0	--
4		--	repeat steps 2-3 for 40 cycles
5	40.0	--	Forever

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.