For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:46832399-46832571 173bp AATATAGGGGCATCGGGTAA TCTTGGCGTCTTCCAATATC
Mut= 164 bp
Wt= 173 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case:
TGCTCTTATGATAATCAAACTCATTGAACTAAATGTGCCCCAGCATTCAATAAAACATTTCTTCTGCAATGCCTTTGGCAGGAAAAAATATATGTGCTAATGGATTTTGAGTCACTGATACTGCAGTTTGGtaaggcagagcccttctgatcctgtatgaatcttgggaacatggttgagtcatatttcatgtgttggaataggaaaaagaactctagaaattctctagtaatctagtagtatatctccctattttaattttttgcataaattcctatggaaagcatggctcttatgtgtttgtattacagtatttcaagtgatatttagagtattttaattgtacaataatattttctgcataatcttaaaaacctgcttatactcagtttgttttatccgtttccttgcagtgtttgaacgtcactcagttgttaaaacactttggtcttggtccgaactctcccatctcaccggatctattcacgtacctttgccctgcattgctgtatcagatcgacagcagactttgtattgaacattttgacaaacttttagttgaagatttaaataaggataaaactctggttcctgaagataagacaaatataggggcatcgggtaagaaagacttttttcctctttaaggtagTACTCATACTGTCCCTTAAATTATTTATTAAAAAGAAAGACTAAATTGTTAGTTTCATTTCAGTGTCAGATTTTAATGATCCAATCAGATTTAGATATCTATATAAGATATTGGAAGACGCCAAGAGGCTTATTAGTATTTTTATTTTATTTCCTCTGGCCCTG^TAGAGGAGTGTTTTGTTGAAAACAGAGAAAAAGATTAAAAAGGAAATAGAAATCTTTTTGACAATCAGCCATAAAATGGGAACTCTGATTAAAGTT
This mutation is a 521 bp deletion beginning at Chromosome 1 position 46,832,525 bp and ending after 46,833,045 bp (GRCm38/mm10). In addition, there is a single bp (A) insertion 164 bp after the exon deletion that will not alter the results of the exon deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40956 | AAT ATA GGG GCA TCG GGT AA | Wild type Forward | A | |||
| 40957 | TCT TGG CGT CTT CCA ATA TC | Common | A | |||
| 40958 | GTG CTA ATG GAT TTT GAG TCA CTG | Mutant Forward | A | |||
| 40959 | Fluorophore-1 | TAA GAA AGA CTT TTT TCC TCT TTA AGG TAG | Quencher-1 | WT Probe | ||
| 40960 | Fluorophore-2 | TGC AGT TTG GTA CTC ATA CTG TCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40956 | 0.40 uM |
| 40957 | 0.40 uM |
| 40958 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.