For in-depth product & services help, ask our
Technical Information Scientists
>chr5:65421256-65421475 220bp TGTTTCTGAGGCTGTATTTCAC AGAGGCACAGGCACGATTAG
Mutant = ~320 bp
Heterozygote = ~320 bp and 220 bp
Wild type = 220 bp
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
42390 | TGT TTC TGA GGC TGT ATT TCA C | Forward | A | |||
42391 | AGA GGC ACA GGC ACG ATT AG | Reverse | A |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTPS-kapa | 0.26 mM |
42390 | 0.50 uM |
42391 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.