For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:28460010+28460117 108bp CCGTATGTACCAAGTGCAATACA GGACAGGATGTCAGGGTTAGA
Mut= 108 bp
Wt= 108 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TATGCTAGCTGCTTTGAAATCTGTTGTCCAGAGCCCATTCATTGGGGGATAAAAGATCCAGTTTGACTCTCAGCAGCACACCCCAGTTGACTATCTTCCTTCCCTCCAGGTCTCTCCCATTCCTGCCTCCCCCCTGCACCATGGCTccaggccccttctcctccgggctcttttcgccaccacctgctgctcttccctttctgctgttgctctgggcaggagcatctcgaggccagccctgccctggtcgctgcatctgtcagaacgtggcacctacgctgaccatgctgtgtgcgaagacgggcctgctctttgtgccacccgccatcgacaggcgtgtggtagagctgcggctcactgacaacttcattgcggctgtgcgtcgtcgagacttcgccaatatgaccagcctggtccacctcaccctgtctcgcaacaccattggccaggtagcagccggcgcctttgctgacctccgggctctccgggccctgcaccttgacagcaaccgcctggcagaggtgcgaggggatcagctccggggcttgggtaacctccgccacttgatcctcggcaacaatcagatccgtaaggtggagtcggcagcctttgacgccttcctgtccaccgtggaggacctggatctatcctacaacaacctggaggcactgccatgggaggcggtgggtcagatggtgaacttgaacaccctcacgctggaccacaacctcattgatcacattgcggagggcaccttcgtgcagctgcacaaactcgtgcgcttggacatgacctccaaccgtctacataaattgccccccgacggactgttcctgaggtcccagggcggtgggcccaagccacccaccccattgacggtcagcttcggtggcaacccgctgcactgcaactgtgaactgctctggcttcggcgcctgaccagggaggacgacttggagacgtgtgccacgcccgagcatctcactgaccgctatttctggtccatcccggaggaggaatttctatgtgagcccccgctcatcacacggcaagcagggggccgggccctggtggtagagggccaggctgtcagtctgcgctgccgggctgtgggtgaccccgagcccgtggtgcattgggtggcacctgatggacggctgctggggaactccagccggactcgggtccgtggtgacggaacgctggatgtgactatcaccaccctgagggacagcggtaccttcacttgcatagcctccaatgctgcgggggaagccacagcacctgtggaggtatgtgtggtacctctgccactgatggcgcccccacccgctgccccgccgcctctcactgaacctggttcttctgacatcgccacaccaggcagacctggtgccaacgactcaaccagtgagcgcaggcttgtggctgctgaactcacgtctagctctgtgctcatccgctggccggcccagaggccagtgcctggcatccgtatgtaccaagtgcaatacaacagctctgcagatgactccctagtctacAGGTGAGTGTGGTACTGCAGCTCCGGGACCTCCTCTCTAACCCTGACATCCTGTCCTCCTTTCCTCTCACCTGCCCATTCATCCCCCTTGACCTTGCTTAGTTCCAGCTCTGGATAGGCCTGTAGTGCCCCCCCCCCCAACGCAGTCTTTGT
This mutation is a 1398 bp deletion beginning at Chromosome 7 position 28,458,664 bp and ending after 28,460,061 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42878 | CCG TAT GTA CCA AGT GCA ATA CA | Wild type Forward | A | |||
| 42879 | GGA CAG GAT GTC AGG GTT AGA | Common | A | |||
| 42880 | CTT CCT TCC CTC CAG GTC TC | Mutant Forward | A | |||
| 42881 | Fluorophore-1 | CTC TGC AGA TGA CTC CCT AGT CTA C | Quencher-1 | WT Probe | ||
| 42882 | Fluorophore-2 | CTG CAC CAT GGC TAG GTG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42878 | 0.40 uM |
| 42879 | 0.40 uM |
| 42880 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.