For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 95 bp
Wild type = 93 bp
>chr9:112912424+112912516 93bp TGCAGATATTCACAACCAATCA GGTTACAATCCCCTTCAGCTC
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 9.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
Sequence
Wt Sequence: AGCAGAGCCTGAAGGAAAGGTCATCCAGAGACTGTCCCACTGTGTGATCCATTCCATCAGCAGACACCAAACCCCGACACTATTACTGATGCTTAGATGTGCTTGAAGACAGAAGCCTGGTATGGCTGTCCTCTGAGAGGGTCTGCCATCACCTGACTAAGACATATGCAGATATTCACAACCAATCATTGgCCTGAGCCTGAGGACCTTAATGGAAGAGTTAGGGAAAGGGATgaAAGAGCTGAAGGGGATTGTAACCCCATAGAAAGAACAAGAGTATCAACTAACTGGACCCCTCAGAGATCCCAGAGACTAAACCACCAACCAAAGAG
Mut Sequence: GCAAAATGGAGCAGTATTTGAACATGGTAGAGTAAGCGAGAACACGTTTGATGTCGGTCTGTACCAGCGCGGCAAAACCGGCCAGCAGCAGCGTaaagagctgaaggggattgtaaccccatagaaagaacaagagtatcaactaactggacccctcagagatcccagagac
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42433 | ATG GTA GAG TAA GCG AGA ACA CG | Mutant Forward | A | vector | ||
| 43137 | GGT TAC AAT CCC CTT CAG CTC | Common | A | mChr9 | ||
| 43138 | TGC AGA TAT TCA CAA CCA ATC A | Wild type Forward | A | mChr9 | ||
| 43139 | Fluorophore-1 | ATG TCG GTC TGT ACC AGC GCG | Quencher-1 | MUT Probe | ||
| 43140 | Fluorophore-2 | CCT GAG CCT GAG GAC CTT AAT GG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42433 | 0.40 uM |
| 43137 | 0.40 uM |
| 43138 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.