For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:71519014-71519163 150bp GGAGGAAACTAGATTTGATGACAG ATTCCAGATTACTGTGCACTTACAG
Mut= 150 bp
Wt= 150 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GAAGGAGGACTATGGACTATAGAATGAAATCATCTCCAAAAACAAAAAAGGAAGACGAAACTCCAGGGAGGAAACTAGATTTGATGACAGATAATCACAAATGTGTAATGGAAGTACACTGAATTTAAGAGTATAAGAGTATttaaggagtggctactattcttggttgttaaacactgcaatgtaaggagctgtaagtgcacagtaatctggaattgagtaaagtcacaaaatcctggatgggcaaactcagcagaaaagactcaaatatcttcactacacgctaggactgcgcagtgtctgtgcggctttgaaacgtaacttctagtgtagctggtatgcttcctgatgtgatggcacctttttttttctttcctggtttctcataggtatcccttcacactgtccaagagctccatgtatacagtgggagcccctcacacgtggcctcacatcgtggctgccttggtgtggctcatagactgcatcaaggtatttagccaatgGTTCTTATCTTACCTATAGAGATTTGGGGTTTGTTGTTTTCTTTTCCTCACAAAGGTTTTCAATTCCTCTCCCCAATCATATTTTGCAACTTGTCCGAAAATCTGCTTCAGTTTTCAAATCGCATTTGATTTGAAGTTCTC
This mutation is a 364 bp deletion beginning at Chromosome 17 position 71,518,724 bp and ending after 71,519,087 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43749 | GGA GGA AAC TAG ATT TGA TGA CAG | Common | A | |||
| 43750 | ATT CCA GAT TAC TGT GCA CTT ACA G | Wild type Reverse | A | |||
| 43751 | GGG GAG AGG AAT TGA AAA CC | Mutant Reverse | A | |||
| 43752 | Fluorophore-1 | AGG AGT GGC TAC TAT TCT TGG TTG | Quencher-1 | WT Probe | ||
| 43753 | Fluorophore-2 | ACC TAT AGA GAT TTG GGG TTT GTT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43749 | 0.40 uM |
| 43750 | 0.40 uM |
| 43751 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.