Protocol 34786: Probe Assay - Arhgap20<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr9:51825862+51826026 165bp AAGACTACCCGAAGAGCATCC CACACGCACAGTCTTTCAGC

Mut= 166 bp

Wt= 165 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

 CTCCTCCAACATCAGTTGACATGGATATCCCATTCTTTGGCGAGTTCCATGCCTAATATCAATTTTTTTCTCTTTTATATAATCTGATTCGGCTGAGTTTTACCTGTATCCTTAAAAAAAGAAAAATGAGAAAAGAGAACATTTAAGTATATTGACAATGTTatcaagataggtttggtttttttttttttgttttgttttttttaatgagctattagtgaatctcatttgactcagtgttgttttggattatcacatttgattagatacatcgctctagaaaaggagaaagactacccgaagagcatccccctcaaaatctttgccaaggacattggaaactgtgcctatgtaagtgtttctaagccagtaaacgaaatccaaggtccctgtataagagcaaaaacattgtggatgaaaaaggagacaggcaggctgaaagactgtgcgtgtgtcctatagaAGGCAGGCATTTAGAGGTCCTGTGGTGGGGGTGTGCATCTATATGTATCTTTAAATGCATGAAAGTCAAGTTCTGGAGAGAATGGAAAAAGGGACATTCCTGCAGTATTTAACATGTAGCCCTGGATAGAACATTGCTGGTCAGAAATCTCTTCTCGGGGCAT

This mutation is a 301 bp deletion beginning at Chromosome 9 position 51,825,735 bp and ending after 51,826,035 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
44447 AAG ACT ACC CGA AGA GCA TCC Wild type Forward A
44448 CAC ACG CAC AGT CTT TCA GC Wild type Reverse A
44449 CGG CTG AGT TTT ACC TGT ATC C Mutant Forward A
44450 CCC TTT TTC CAT TCT CTC CA Mutant Reverse A
44451 Fluorophore-1 CCA AGG ACA TTG GAA ACT GTG Quencher-1 WT Probe
44452 Fluorophore-2 ATT GAC AAT GTT AGG CAG GCA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
44447 0.40 uM
44448 0.40 uM
44449 0.40 uM
44450 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.