For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 033160
Protocol 35020: Probe Assay - Nphp3<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:104005588+104005706 119bp AACTGCACAGATGTCACTGGT CAGAGTAAGCACTAATCCTGCAC
Mut= 122 bp
Wt= 119 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGAGGGAAACAAATGTGTCCCATGTCACACACACCCATGCTGTCAGACTTCCAGCAGGTTCCACTGCGAACAATAAAATGAGGGTCCGAAGAAGTATTTCTGTTACAGATGAGGAGACTGAGAACCAAATGTATTTTGACTTTATGAATAAATGTTTTTACCCCcccccctgaaaacttggtggcacaattctgtgattacggaaaaaacgtttcaaaattaaactctaccttttaaaaagatttttagggaaaccaaagaaaatgaaattcaggacttactgagggccaagcgagagttggagagcaaacttcagaggctgcaggctcaggggatccaagtgttcgaccctggggagtctgactcggatgacaactgcacagatgtcactggtgagctcatttcgtgtcccactttccacagagCTGTATGGATGCTCGAGATGGTCAGTCATCCTTTTGCTCTCTGTGTGCAGGATTAGTGCTTACTCTGCTCTTACAAATGGGAGACCTTCTGTGTCTCTCTCAGCTGTCAGGACATCATCTCCTCTAAGTGTATGATGTCAGGAGCAAC
This mutation is a 261 bp deletion beginning at Chromosome 9 position 104,005,379 bp and ending after 104,005,639 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45044 | AAC TGC ACA GAT GTC ACT GGT | Wild type Forward | A | |||
| 45045 | CAG AGT AAG CAC TAA TCC TGC AC | Common | A | |||
| 45046 | TGA GGA GAC TGA GAA CCA AAT G | Mutant Forward | A | |||
| 45047 | Fluorophore-1 | CGT GTC CCA CTT TCC ACA G | Quencher-1 | WT Probe | ||
| 45048 | Fluorophore-2 | CCC CTG TAT GGA TGC TCG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45044 | 0.40 uM |
| 45045 | 0.40 uM |
| 45046 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.