Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr9:104005588+104005706 119bp AACTGCACAGATGTCACTGGT CAGAGTAAGCACTAATCCTGCAC
Mut= 122 bp
Wt= 119 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletion in lower case):
TGAGGGAAACAAATGTGTCCCATGTCACACACACCCATGCTGTCAGACTTCCAGCAGGTTCCACTGCGAACAATAAAATGAGGGTCCGAAGAAGTATTTCTGTTACAGATGAGGAGACTGAGAACCAAATGTATTTTGACTTTATGAATAAATGTTTTTACCCCcccccctgaaaacttggtggcacaattctgtgattacggaaaaaacgtttcaaaattaaactctaccttttaaaaagatttttagggaaaccaaagaaaatgaaattcaggacttactgagggccaagcgagagttggagagcaaacttcagaggctgcaggctcaggggatccaagtgttcgaccctggggagtctgactcggatgacaactgcacagatgtcactggtgagctcatttcgtgtcccactttccacagagCTGTATGGATGCTCGAGATGGTCAGTCATCCTTTTGCTCTCTGTGTGCAGGATTAGTGCTTACTCTGCTCTTACAAATGGGAGACCTTCTGTGTCTCTCTCAGCTGTCAGGACATCATCTCCTCTAAGTGTATGATGTCAGGAGCAAC
This mutation is a 261 bp deletion beginning at Chromosome 9 position 104,005,379 bp and ending after 104,005,639 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
45044 | AAC TGC ACA GAT GTC ACT GGT | Wild type Forward | A | |||
45045 | CAG AGT AAG CAC TAA TCC TGC AC | Common | A | |||
45046 | TGA GGA GAC TGA GAA CCA AAT G | Mutant Forward | A | |||
45047 | Fluorophore-1 | CGT GTC CCA CTT TCC ACA G | Quencher-1 | WT Probe | ||
45048 | Fluorophore-2 | CCC CTG TAT GGA TGC TCG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
45044 | 0.40 uM |
45045 | 0.40 uM |
45046 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.