Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr4:130264184-130264272 89bp CATCCAGAACGGGTGAGG GATCTCTGGGGACAGGCAGA
Mut= 86 bp
Wt= 89 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletion in lower case):
TCTTAGTGGTTCTACTGAAGACAGGAGGGGAAACCGTTCTGGGAAGCAGGGCTCCACATGTAGCAGTATTGAAATAGGGGGTGGGTGAAGAGGGGTGGGGGTGGGGCGGAGAGCATCAGGGAAATGATCAGCTAGGCGGGAGCCGTTTATGGATTAGGGGCCTGGGTGGCCTTTTTTAGTGTTTAgagcaacacggggtgggaaacaggccttagagatggaggcaggctcagacctgatggcagactgcagggttctggtgggtgggacccctcaatcctccctgttgtctccacagctgccctgggtgtgtgaggacaggacccagcaacccctggtcctgcaggggcccctggactgcggctccctgctgggtttccgcgctgtctaccgtatgtgctttgccacagcagcctttttcttcttcttcatgctgttaatgatctgtgtccgcagtagccgggatccgcgagcagccatccagaacgggtgaggggcggccacctacaccctggcacactcccctgGGGGGGGGCTTTTGTCCCCTCTGCCTGTCCCCAGAGATCTCTAGACTCCATCCTCAGACTCATTAGAAGCCAGAGGTCAGCCTCGTCTATCCCTAGGAGCCGCCCACACCTTTCATTTTGTGAAACAGGGTATCTCATCTGGGGCTGATTCCACTAGCCTGGCTAG
This mutation is a 342 bp deletion beginning at Chromosome 4 position 130,264,223 bp and ending after 130,264,564 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
46144 | CAT CCA GAA CGG GTG AGG | Wild type Forward | A | |||
46145 | GAT CTC TGG GGA CAG GCA GA | Common | A | |||
46146 | GGA GCC GTT TAT GGA TTA GG | Mutant Forward | A | |||
46147 | Fluorophore-1 | ACC TAC ACC CTG GCA CAC TC | Quencher-1 | WT Probe | ||
46148 | Fluorophore-2 | CTT TTT TAG TGT TTA GGG GGG G | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
46144 | 0.40 uM |
46145 | 0.40 uM |
46146 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.