For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:22823048-22823183 136bp ATTCACAAAATGTTATGTCAGGGTTA CCCAGGGAACTGATTCATAAGT
Mut= 144 bp
Wt= 136 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TATTGCGGGATCCTCCGGTAGTACTATGTCTAATTTTCTGAGGAACCGCCAGACTGATTTCCAGAGTGGTTGTACAAGCTTGCAATCCCACCAACAATGGAGGAGTGTTCCTCTTTCTCCACATCCTCGCCAGCATCTGCTGTCACCTGAATTTTTGATCTTAGccattctgactggggaggaataatcacatcaatttgtaaaccaattggtaattgacttattcactttgttagattgacttttctttcaggttgcttttgatataagccattttcttttcttattcatgtttgttctttagtgtgtttactagattcaaaaataacaattgctgcttcataacaaggttaccacttagttaaattacctatatgaataaaaccagagacacattgcttcccatctttcagaacttagtcaacactagttgtagatgatctagcatattacttaaactgtcaatctttcttcctaacagatgactctgctgcagagagctctaatggcaatgagactctggggcacagctcagctgcttcagggggagcacatggcagggagcccgaggactccagcagtgatggcaaaaccgggctggagcaggaagagcagccactgaacctgagtgacagccccagctctgcacagctcacttcagagttcaggatagatgaccaaggcagtgatgggaaaaacaagtataagaatcttctaatctctgacctcaagatggaacgagaagcgagagaaaatggaagcaaggtaaggcttcactacattgctgagtgggctttatgttggtcatgaagattaagttggtaacacatgaacattactaataaatgcataaccatgcattatgtatattcacaaaatgttatgtcagggttaatagagccaagtgaaatttatctcaaagctgtgGTTATTATTTGATATAGAGAATTGTTTGATTTAATGCATTTCATTTCTATAATCTACTTATGAATCAGTTCCCTGGGAATTTTCCAAGTGCAAATGTAAAAGGTTTGGTCTCAGTTCACAATTTTGAACAATAAAAGGATCACTCATTTCTCTA
This mutation is a 763 bp deletion beginning at Chromosome 18 position 22,823,125 bp and ending after 22,823,887 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46197 | ATT CAC AAA ATG TTA TGT CAG GGT TA | Wild type Forward | A | |||
| 46198 | CCC AGG GAA CTG ATT CAT AAG T | Common | A | |||
| 46199 | TGG AGG AGT GTT CCT CTT TCT C | Mutant Forward | A | |||
| 46200 | Fluorophore-1 | GCC AAG TGA AAT TTA TCT CAA AGC | Quencher-1 | WT Probe | ||
| 46201 | Fluorophore-2 | TGT CAC CTG AAT TTT TGA TCT TAG GTT A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46197 | 0.40 uM |
| 46198 | 0.40 uM |
| 46199 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.