For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:23378945-23379073 129bp GACCCAGTGTTCAGGCAATAC GAGGATCAAAGACAAGGAATTAGTC
Mut= 125 bp
Wt= 129 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (T insertion):
CTCAGCCTGTTGTCAAATGGGGAAGTGGTATGGTCAAACCGTGTAGAGGTGTCCAGCCTTTGACACTGTCGTATGATATCCTTTACAAATGTGTTGGGATGCATTAATATACTATAGGATGCATGAGGCCCACAGGGTATGGTTAGATGTGGCCCTTTCACAGGAGACCAGGGACCCAGTGTTCAGGCAATACCG^ttgggatgatgcaatgcaagctctgtcttcctacagatttatgggaccaaacagttgtcctttctccaggttgcatcagaagactaattccttgtctttgatcctctccctttcaggccattatgtctatatggacacctcttttgccaggcaaggggagaaagctgtgctgctgagttctgatttgcaggctgaggagtggaactgtttgcgcctggtctaccagataaccacacctccgggatctgtgtcagaccccagccagctgaacctctatgtgagatttgaggatgagagcttcgatcgcttgctttggtccactaaggagccttcagacagctggctcatagccagcctggatcttcaaaacagctccaagaaattcaaggtaggtggggtttaagaggaagatgtgagggtgtgtaacatgtgttctatgctatatg^AGGTCTTAGAGAAGTGGTTCCAACCTTCTGAATGCTACAACCCTTAAATACAGTTCCTCATGTTGTGGTGATTCTCCAACCATAAAACTTTTTTTTGCTGCTACTTTATAACTGTAACTTTGCTACTGTTATGAATTGTAACATAAGTTTCTGTGTTTTCTGAGGGTCTTAGACAACCCCAATGAAAGGGTCATCTA
This mutation is a 446 bp deletion beginning at Chromosome 19 position 23,378,605 bp and ending after 23,379,050 bp (GRCm38/mm10). In addition, there is a single bp (T) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47645 | GAC CCA GTG TTC AGG CAA TAC | Common | A | |||
| 47646 | GAG GAT CAA AGA CAA GGA ATT AGT C | Wild type Reverse | A | |||
| 47647 | GCA GCA AAA AAA AGT TTT ATG G | Mutant Reverse | A | |||
| 47648 | Fluorophore-1 | ATG GGA CCA AAC AGT TGT CCT | Quencher-1 | WT Probe | ||
| 47649 | Fluorophore-2 | CGT AGG TCT TAG AGA AGT GGT TCC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47645 | 0.40 uM |
| 47646 | 0.40 uM |
| 47647 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.