For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:25966388-25966469 82bp GTCTGACAGGCATTCCTCTGTTC GCAAACCTCACCATCTGACC
Mut = 105 bp
Wt = 82 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CCTAAACAAAAGCTGTTTGGTCTCTGCTTGGTACCTGACCTTGACTTTGGAAAGAAGATAAGCAGAGCTCCCTTCTCAGAATGAATGTCATTGTACCATAGCCCCttctttaatccgatggcatcttggtttcctttgagctctctagcatcccaggaaatttgtgcttgcgtcccaccatcattcagattatgctggcctttgcacaaatgcctcattgtgcctctgtcgtgctaatgaggctgttagttgaccctagatctttgtgtgttgtgtgtggtaccttggctgggattttgctggacggtgcttttgtgtgttctcatctggctggtgatgcttgagactggactgtgcatgtccattcacccagtgctctctctcctgccatagacaacatccctgaggacctccgagacccgttttacatcgaccagtatgagcaggagcacattaagccacccgttatcaagcttctcctgtccagtgagctgtattgccgtgtctgcagcctcatcctaaaaggggaccaggtggctaccttgcaaggacaccagtctgtcatccaggccctgtcccggaagggcatctatgtgatggagagtgatgatacccctgtgacagatgctgacctcagccaggcacctattaagatggtgagtgttgccgggcgtggtggcgcatgcctttaatcccagcacttgagaggcagaggcaggtggatttctgagttcgaggccagcctggtctacaaagtgagttccaggacagccagggctatagagaaactctgtctcgaaaaaccaaaaaaaaaaaaaaaaaaaaaaaaccaaaaaaaaaaaaccccaaaaaacaaaacaagatggtgagttgtctgacaggcattcctctgttcccttggctgagcaggcaagactcagtgcccttccatTAGGGTCAGATGGTGAGGTTTGCCAATGTGTATTGGTGGACCTTAATGACAGACCTGCATTTTAAAGAATGTCATCATTCTGGAAAGAACAGCTTGCTTTTGGG
This mutation is a 826 bp deletion beginning at Chromosome 2 position 25,966,411 bp and ending after 25,967,236 bp (GRCm38/mm10). There is a single bp (T) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49900 | GCA AAC CTC ACC ATC TGA CC | Common | A | |||
| 49901 | GTC TGA CAG GCA TTC CTC TGT TC | Wild type Forward | A | |||
| 49902 | TGC TTG GTA CCT GAC CTT GA | Mutant Forward | A | |||
| 49903 | Fluorophore-1 | CTT GGC TGA GCA GGC AAG A | Quencher-1 | WT Probe | ||
| 51297 | Fluorophore-2 | AGA GCT CCC TTC TCA GAA TGA ATG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49900 | 0.40 uM |
| 49901 | 0.40 uM |
| 49902 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.