For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:139256340+139256442 103bp AACCGTAAGAAGAAGGGGATG TTTCAAACTGGGTCAAGAGC
Mut = 101 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGGTGACAGGTGCTGGGCAGAGCTAGAGTTCTCCCTTATTCTCACTCTGACTCTGTTCCCTTCTACCAGGTCTGGCctctttggcctgtctccatctactctactgcctctggctgacaactcctctgccgtcagctgtcatggccaggctcccgaggagggaactggagaagtgatgcagctagagacaggacctctgcatcctcaccacaaagaccctgagaaggatcagcctcccaagacagctgtgtctgagccgcccccacctctcataccacctgtgcctgccgggaacctgcctccctttccaccatactttgagggtgcccccttccctcacccactatggctgaggaacacctaccagcagtgggtgccgcagcccccacccaggaccatcaagcggacccgtcggcgactctccagaaaccgggatcctggaagactcattcttagcacaatccgcctgcggccacgtcaggtactgtgtgagaagtgcaagagtactgtgagtcctcaagaggccagtcccagccccctgaacacccccaaaccccgccggaggctaggcagtggccctgacagtgaacaccgaaagccagaggaaccagaagacagcgctgtcatagctacagctgccccgaggaggagcaagagggagaagcgggaagaggacagggttgctggagagcgtgttccgagaagcccagtcatcaagatctcctacagcacaccacagggtaagggtgaggtggtcaagattccatccagagtgcatggctccgtggagcccttctgcccgcaacagtctctacagaatggcagccaggactcagaggtatcaagggatgtggagcccaggggtggtggagaccgaccacccagcgggtcttcagcctccatccccaagctaaagctgactcgcccagtgcctcctatctctgacctgccacctcccaaaatccgcctgaagccccaccggctgggggatggagagcatgaacccctttaccgggctgagctggtggaggagctgaacggatgcccacgaggcccgctggtcagctcccctgctctctttgccgatggctctagccatgggctagaggacttgtcttctggaagttctggtgaggacgatgacctcaagaggtttccccaaggtaaacatggccgtgatggcttggcttttcttgtggactgccctgggaggagaacagattgtaccagtgaatctgtgtgcagcacggacagcctggatgaattaaaatcatctggttcagaagtgacatctccagacacaggagacctgtcatctggtgacagtgcctctgttccttcatcttctgctgacactcgccagacagtccctcccctcacggtcaggctgcacacgcagagcgtctcacggtgtgtgactgaagatggaaggacggtggctgtaggggacattgtgtggggtaagattcatggttttccttggtggccagcgcgtgtccttgacatcagccttggccagaaggaggatggagagccctcttggcaagaagcgaaagtctcatggtttgggtctccaactacatcattcttgtctatttcaaaactgtcccctttctctgaatttttcaaactgagatttaaccgtaagaagaaggggatgtatcggaaagctataactgaggctgcaaatgccacacaacacgtggcCCCAGAAATAAGGGAGCTCTTGACCCAGTTTGAAATGTAACTTTGGTTCCAAGAGC
This mutation is a 1631 bp deletion beginning at Chromosome 7 position 139,254,777 bp and ending after 139,256,407 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51456 | TTT CAA ACT GGG TCA AGA GC | Common | A | |||
| 51457 | AAC CGT AAG AAG AAG GGG ATG | Wild type Forward | A | |||
| 51458 | TGC TGG GCA GAG CTA GAG T | Mutant Forward | A | |||
| 51459 | Fluorophore-1 | CGG AAA GCT ATA ACT GAG GCT G | Quencher-1 | WT Probe | ||
| 51460 | Fluorophore-2 | TAC CAG GTC TGG CCC CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51456 | 0.40 uM |
| 51457 | 0.40 uM |
| 51458 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.