For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:51861204-51861309 106bp GCCTTGGATGGAGATTTCG CAGCCTGGGAACTGAGAATCTA
Mut = 99 bp
Wt = 106 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GCTCATGTCCAATCGGCTCGCGCCTCGGGATGTCAGGGCGGAAGCGGCcgccatggagccgcttgtgcagcaaaccgagcgattctccgagctgttggccgtgtcgtgtgggtcgctggtgagcacgtgggacgccgaaaaggtgcgcagggcgctgcagtgggcgcgttatctgctccacgtgtaccgacgcttcgcgggccgcggccgcgtgcgggaggcgctcgagaggcggctccccgcgcggggagggccgctcgggctgcgcagcttcgcggcgctggagtccggggacgcgcggctcgccctccgcctgctgcggaaccgcgcgctcgcgcccgccgccgcccgcgcgctgccgagcttgctgttcccgggccccgccgcggaccaccgagacgacgtgccgcagtcgcgcctggtcctcctggcgcgccgcggaagcgcgctgcgcctgctgtgccgcctcggcggggacgcgcccaggagcgcgctgctgcgcacgcacgcggagctgctggacgcgcgcctgcacgagctgggcggggccgactccgcggccgcgcgcaaactcctggacacgttgtggacgcgcgggccgcgggagcacgtgctcgacgtgactgccgaagcgctgctgctacgcgaggaagacccggagccagcccaggccacggaccctgcgggtgcggatgagacacagaaactactgcgctggcttctcgaaagtcccgaggtattggccgctttttgccgccatctgccagccaagcgcctggcctccgtggcgggctgccaccacgcactgtctcgcgcctacctggacctgctcacaacgtgggccacgcggctgcactatgatctgcaaaagggtgcctgggtccctacacagatggaggacatgccctgggaagagctgtgcctaaggctgcagagcttgtgccatgcccagccatttctgcaggaagaggtgctggtgaccctaaggtcccgcaaagccttggatggagatttcgaggttcctgggatgagcatctggacagacctcctggtggtgcTTGAGTGTGGGATCGTGCTAGAGTAGATTCTCAGTTCCCAGGCTGGG
This mutation is a 1010 bp deletion beginning at Chromosome 7 position 51,861,249 bp and ending after 51,862,258 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51862 | CAG CCT GGG AAC TGA GAA TCT A | Common | A | |||
| 51863 | GCC TTG GAT GGA GAT TTC G | Wild type Forward | A | |||
| 51864 | GCT CAC GCT CAT GTC CAA TC | Mutant Forward | A | |||
| 51865 | Fluorophore-1 | CCT GGG ATG AGC ATC TGG A | Quencher-1 | WT Probe | ||
| 51866 | Fluorophore-2 | AGG GCG GAA GCG GCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51862 | 0.40 uM |
| 51863 | 0.40 uM |
| 51864 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.