For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 120 bp
Wild Type = 128 bp
>chr17:80274675-80274802 128bp TCCCAAGTAACACTTTCCTTTC TCCTCATCTAGCCTCAAAGTG
Sequence
Wt Sequence (deletions in lower case):
TGTCATTTCCCAAGACAGAAACTAACAGTTCACTATAAGATGAAACCAGCAACTgaagggcagggtcccaagtcgttggctctttgattaaatgcttacacccttgcttaatttttctctgaaataagtagacattaacatccaatattttaaaatgtccccttccctagaagaggcacctctggggaggaggaagacagcgagccccagtgtggcgaggagcagggctggccagctggacaagagcctatctttcttcctgactgcagtccttgggaatatataggcccagaagaagtggagcctcctgtgccagaatgtgcagtctcacccttggcagtgcagaaactttccaggtgatcactttatcacttacagaagtctcttctctgtggatgccctatcatgacagtgcccgtagggcccaatatgctgacaactcgatcttttaaaatggagggattattattatctgggatgctttttccaaatacagaatgtagctgtccacagttgtaactccatatttgtatttaagtgactctcacgtcagtgatgtgaagacttttacacagcatctttgtcatgttttgccctcggcaggtacggcttccacactgagcactgtcagctggccctgaggatctgtgatggagacttaggggcggcactagagcatcttctccgccagtgtttctcagagacgtttggagagaggatggcgctctctgaggcagctgtttatgtgagcttgaatgagtgtgtggagcagagacaggaagagacgcttgctctcaagtccatctgcggagaaaaattcatagaaagaattcagaacagagtctggaccattggattggaactggattatttgacaaacaaattctgcaagtctaagcaaaaggaaagtagcaaaaatgtacgggacacttcgcctgaaacctgtaaattttacctcaaaggaaattgtaaatttggatcaaaatgcaaattcaaacatgaagtgcccccacatcaaatgattgggagagcagaaagaaacgtaaatgaccctcaccttgacgctgatgacgacacaacctttatgtatgagcttcagattcgcttttctaaagaccacaaatacccctaccaagctcccctggtggcattttattccaccaatgagaacctacctctggcttgtcgtttacatatttctgagttcctttatggcaaggccttggaatttgcaaaaacttcagaacctgttgtctattctctgatcacccttttagaggaagagtcagagattgtcaagttactaacacacactcaacataagtatagcgttcctcctgtgaacgtccctccagtaccttccgagaccagaataagtaaacctgcctaccgcaaaccagtggtcccaagtaacactttcctttctaatcaaatgctagaaggtacgtacagtattgctcctaggGACAGGATGGGATCAGCAGTCAGAGTAGTGAGTTTAAAAGTAAAACACTTTGAGGCTAGATGAGGA
This mutation is a 1411 bp deletion beginning at Chromosome 17 position 80,274,741 bp and ending after 80,276,151 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66027 | TCC TCA TCT AGC CTC AAA GTG | Common | A | |||
| 66028 | TCC CAA GTA ACA CTT TCC TTT C | Wild type Forward | A | |||
| 66029 | TGT CAT TTC CCA AGA CAG AAA C | Mutant Forward | A | |||
| 66030 | Fluorophore-1 | ATG CTA GAA GGT ACG TAC AGT ATT GCT | Quencher-1 | WT Probe | ||
| 66031 | Fluorophore-2 | AAC CAG CAA CTG ACA GGA TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66027 | 0.40 uM |
| 66028 | 0.40 uM |
| 66029 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.