Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr5:69561020+69561134 115bp CAGGTGAGAAAACTCCCCTTA CTGAAAGTGTGTAGAAACCAAAGC
Mutant= 84 bp
Wild Type = 115 bp
Wt Sequence: caggtgagaaaactccccttatattgtgagaatatacagaatcattattaCagaggccccaggaaggaagagtgtagccttaaatctcaatgctttggtttctacacactttcag
Mut Sequence: caggtgagaaaactccccttatattgtgagaatatacagaatcattattaCTatggggctgaagtacactggcatttgtttgcg
A 377 bp deletion beginning at Chromosome 5 position 69,561,071 bp and ending after 69,561,447 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
66159 | Fluorophore-1 | CCC CAG GAA GGA AGA GTG TAG | Quencher-1 | WT Probe | ||
66160 | CAG GTG AGA AAA CTC CCC TTA | Common | A | |||
66161 | CTG AAA GTG TGT AGA AAC CAA AGC | Wild type Reverse | A | |||
66162 | CGC AAA CAA ATG CCA GTG TA | Mutant Reverse | A | |||
66163 | Fluorophore-2 | TAC AGA ATC ATT ATT ACT ATG GGG CTG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
66160 | 0.40 uM |
66161 | 0.40 uM |
66162 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.