Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr9:49470370-49470462 93bp TAACGGCAGCGAAAAATAAG GCACAGAGTCAGCCCTCAGT
Mutant= 87 bp
Wild Type = 93 bp
Wt Sequence: taacggcagcgaaaaataagcagcgctgggccaaactaGaaaaccggcgatctagaaggaccttccgacgtacactgagggctgactctgtgc
Mut Sequence:taacggcagcgaaaaataagcagcgctgggccaaactaGAGTGATggcaaatgtttaccaacaggctgcaagtgccagtttccatgg
A 321 bp deletion beginning at Chromosome 9 position 49,470,103 bp and ending after 49,470,423 bp (GRCm38/mm10). There is a 5 bp insertion ( AGTGA ) at the deletion site.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
66144 | TAA CGG CAG CGA AAA ATA AG | Common | A | |||
66145 | GCA CAG AGT CAG CCC TCA GT | Wild type Reverse | A | |||
66146 | CCA TGG AAA CTG GCA CTT G | Mutant Reverse | A | |||
66147 | Fluorophore-1 | CCG GCG ATC TAG AAG GAC C | Quencher-1 | WT Probe | ||
67120 | Fluorophore-2 | ACT AGA GTG ATG GCA AAT GTT TAC CA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
66144 | 0.40 uM |
66145 | 0.40 uM |
66146 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.