For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:151971032-151971136 105bp CCTCTTTCCTCTCCCTCAGC CCAATCACCAGGCAAAATGT
Mutant= 96 bp
Wild Type = 105 bp
Sequence
Wt Sequence: cctctttcctctccctcagctgtgcgggtccccgcccactActggagggaaatggagtgggtgtggccacaagccttccagtagtacattttgcctggtgattgg
Mut Sequence: cctctttcctctccctcagctgtgcgggtccccgcccactACagtggcttctttctggaaggaaggggctttcagcgagaaggctggcaggaacat
A 1930 bp deletion beginning at Chromosome 2 position 151,969,166 bp and ending after 151,971,095 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68556 | CCT CTT TCC TCT CCC TCA GC | Common | A | |||
| 68557 | ATG TTC CTG CCA GCC TTC T | Mutant Reverse | A | |||
| 68558 | CCA ATC ACC AGG CAA AAT GT | Wild type Reverse | A | |||
| 68559 | Fluorophore-1 | AAT GGA GTG GGT GTG GCC | Quencher-1 | WT Probe | ||
| 68560 | Fluorophore-2 | CGC CCA CTA CAG TGG CTT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68556 | 0.40 uM |
| 68557 | 0.40 uM |
| 68558 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.