For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109bp
Wild Type = 125 bp
>chr15:98676252-98676376 125bp AGGAAAGCGAAGGAAAGAAT CATCCAGAGGTGAACTAGAC
Sequence
Wt Sequence (deletion in lower case):
CCCCGCGCAGGCTTCTGCTGTTTTGCCTGTTCACCTGTGCCAAAGGACTAGAGGGCAGAAGACAGAGGTTAAAACTGGCTTGTGGCTCTGAAAAATGGGACACACATTTAGAGATGTGaggaaaatgcgaatgtatgtgtctcagactagctaggatgtagggggtttgtcccaggctggggagcgaaggccaatacctctacagtccccaatggctccccctcctctggcttctcgccatctgacactttggtgtttctcggcgcatgtgtagccaacgcttggtgtggggttctgagggcatgctgctgccggggtgtgagtgtttcctgtctcctcgcagacctatgtgcctaccgtgtttgagaattacacagcctgtttggagacagaggaacagagagtggagcttagtctctgggacacctcaggtaagagtgtacccccaaatgccccatcctaccaccattggctagccgcagttgctgcttttttaagggggggggggctgggaatccacctttgaagataggtgcttgccaggaaagcgaaggaaagaatgtaaaaaattctttggttggggctttgatgattttagaggatcctggaaggcagtgaacaagcctgGGTGCCACTTGGGTCTCTGGTCTAGTTCACCTCTGGATGGTGAGGTGAAGGGAGCCCTGAGAACTCCCCGGGAGTACCAGACGTCTCCTCTGTCTCTGTCTCTCTCCTCTCCCTTCCTCTCCCTCCTCTCTCCCTCTCTCTCTAGTTCTCCAG
This mutation is a 509 bp deletion of region Chr15:98,676,291-98,676,799
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73195 | AGG AAA GCG AAG GAA AGA AT | Wild type Forward | A | |||
| 73196 | CAT CCA GAG GTG AAC TAG AC | Common | A | |||
| 73197 | TAG AGG GCA GAA GAC AGA G | Mutant Forward | A | |||
| 73198 | Fluorophore-1 | CTG GAA GGC AGT GAA CAA G | Quencher-1 | WT Probe | ||
| 73199 | Fluorophore-2 | TTA GAG ATG TGG GTG CCA CTT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73195 | 0.40 uM |
| 73196 | 0.40 uM |
| 73197 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.