For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:23905129-23905256 128bp CATCGCTGCATCAGGTAA AGCAAGTATTAAGAAGTGAGGA
Mutant= 117 bp
Wild Type = 128 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
gtggttttgagctatcttgtgggcctttcaattgaaccagggtcttctgcaagagcagcaagtgctcctaactgctaagccatctttccagctccaagaatactaaaattcaaatgctcttttataaatcagcaagatttatacCTtggataaacaggtgacatgtttcatttcattttgtttttgagacaggttctcatcaacccagtctgacctttatctcttagtcgttctgttcccacctccagagtcttgaaattatagccgtgcctcacacctggctcag
This mutation is a 1086 bp deletion of Chr13:23,904,591-23,905,676 (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 72818 | CAT CGC TGC ATC AGG TAA | Wild type Forward | A | |||
| 72819 | AGC AAG TAT TAA GAA GTG AGG A | Wild type Reverse | A | |||
| 73532 | Fluorophore-1 | AAG AGA ATA CTC GGC AAT GGC | Quencher-1 | WT Probe | ||
| 73533 | ACG ACT AAG AGA TAA AGG TCA G | Mutant Forward | A | |||
| 73534 | TGC TCT TTT ATA AAT CAG CAA GA | Mutant Reverse | A | |||
| 73535 | Fluorophore-2 | ACT GGG TTG ATG AGA ACC TGT CTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 72818 | 0.40 uM |
| 72819 | 0.40 uM |
| 73533 | 0.40 uM |
| 73534 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.