For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 85 bp
Wild Type = 76 bp
>chr16:58550515+58550590 76bp ACAGGTGAATCTCTCTGAATT TTCTCTGCATAGCCCTGA
Sequence
Large deletion: Mutant sequence with junction in uppercase
tgtaatgtgtatgtccttttcagtgttgtctgttttagtatgcaggtgatagactagagaacaagacttctgtctccgtagcatcttgggtatgtgagcattcaataagtacttttcatgagaatgccttttgttttaaacttaacatttgttgcccttttgtttgtaaattttttacatcgataaatgcattgcgttaTGgagctctgctccatggctactatgattcggaagacagaaacatacttcacaaacttcaaataatttgtagttgagggaccgaattcagtggagggtgggacttagatcaccaaaggatgttactagggggagtttagtaggtttaccaaataaaatttctacttgaagtgcccactgccattgcctgag
This mutation is a a 2,197 bp internal deletion of Chr16:58,729,335-58,731,531(GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 71850 | TGT TGC CCT TTT GTT TGT AAA | Mutant Forward | A | |||
| 73547 | ACA GGT GAA TCT CTC TGA ATT | Wild type Forward | A | |||
| 73548 | TTC TCT GCA TAG CCC TGA | Wild type Reverse | A | |||
| 73549 | CTT CCG AAT CAT AGT AGC CA | Mutant Reverse | A | |||
| 73808 | Fluorophore-1 | CTA CCG AGC AAG ATC CAG | Quencher-1 | WT Probe | ||
| 73809 | Fluorophore-2 | ATT GCG TTA TGG AGC TCT GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 71850 | 0.40 uM |
| 73547 | 0.40 uM |
| 73548 | 0.40 uM |
| 73549 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.