For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 115 bp
Wild Type = 126 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
tacccccatgtcttttcttcattcagttaaatatagtttacagaaacagtacgttcttattttttaactttagggctgttgaaaccatcagcagcaaacgaggcgcagcacatgttgggtttggcttgctctctgactttcttttcttgctctcttttttccaacaagccgtttggactcctgcccacactcttcccttccccaccccgcccctcagtccaggccccgcccccaaggagaccccgccccctctccaaatcccgcccctggccgcttttccaccttgtcgcaaaagactcagcgacgccttacggccggtggcgtttgacgtctaggaggcaaccaagaagaagGTcctgctctcggccaccgtttgcacaagacacccagcactgagcatcctgctgccgcatgaacagggagcctttggaaggaccaaccctttgtgccttgtgggggacagtggctcaggagcgctgtgggtacaggagtctgcactggagggaaggagggccgaggacttgtgtaagttttccagtcagtaaacaaacccatagggagcatacttgaagctgagcgcacccctccacttcccccatttcttcttctatcccaggaaatagatcctttttgaagacgtgtttaggaaaaattgtgttc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTTGGGCGGCGGGCCCGATG and GTGGCCGAGAGCAGGACTCG. This resulted in a 5,722 bp deletion of Chr4:147,940,909-147,946,630 (GRCm38/mm10) that removes exons ENSMUSE00000334978, ENSMUSE00000661657 and ENSMUSE00000661656.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 74877 | TTT CCA CCT TGT CGC AAA | Mutant Forward | A | |||
| 76850 | TGT TTC TGC AGC TTG GCT | Wild type Forward | A | |||
| 76851 | CTG GGT GTC TTG TGC AAA | Common | A | |||
| 76852 | Fluorophore-1 | TGG TAA ACA GTG CTC TCT TG | Quencher-1 | WT Probe | ||
| 76853 | Fluorophore-2 | CGT TTG ACG TCT AGG AGG CAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 74877 | 0.40 uM |
| 76850 | 0.40 uM |
| 76851 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.