For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 114 bp
Wild Type = 124 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
ccctctaggctatcacttgtgaaagactctgttctaactgcaactttctgggataatcttggacttgaggtacaggaccttccttaaagttgtgggttaggcagcacttgctccactacccaccattcataccaagtcaccatttccacgaccttgccatctggctccagtacccggaacactaacagttccagaaacagcaggaattgccctcccaatctcattcttgggaatgtatccagggtgacctagagccttctggacagtgggtgcaacgaggtcatcccttaccacagccaGAgtgtgatacccaatcatgattccctcagctaagatcaggatttccaaagtagatcagcaagggacaggtgtacatgtactgttggctaaagggacagggttgaaacaaatgtagacaaaaggctcaggcaaactcacggatgccacttgagtctcctctggcaaggaaaattctcagatcacagagcaaaaagttagagacatcagaaagttcaactgtagctatgctcatcctacactggaagcagaagagatgataaacagtcagacacagagaatttagacagcaaaccaagttgtactgtgttggggaagccaggaaggaggcaggggtgttacgttaattaagctttgacttcc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATCCCTTACCACAGCCAGGA and ATTGGGTATCACACTCTAGT. This resulted in a 4,734 bp deletion of Chr7:43,966,617-43,971,350 (GRCm38/mm10) that removes exons ENSMUSE00001056438 and/through ENSMUSE00000470956.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76864 | TCC TCT GTC CTG TTG CCA | Wild type Reverse | A | |||
| 76865 | CTG TCC CTT GCT GAT CTA C | Mutant Reverse | A | |||
| 76866 | Fluorophore-1 | ATC CAA CCC TGT CAG CAA | Quencher-1 | WT Probe | ||
| 77660 | CCT TCT GGA CAG TGG GTG | Common | A | |||
| 77661 | Fluorophore-2 | ACA GCC AGA GTG TGA TAC CCA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 76864 | 0.40 uM |
| 76865 | 0.40 uM |
| 77660 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.