C57BL/6NJ-Nudt16l1^em1(IMPC)J/Mmjax

Stock number: 037762

Description

This CRISPR-generated knock-out mutant of the gene nudix hydrolase 16 like 1 (Nudt16l1) has been generated by the Knockout Mouse Phenotyping Program (KOMP²) at The Jackson Laboratory.

Detailed description

Although Nudt16l1 is a member of the nudix (nucleoside diphosphate linked moiety X) hydrolase family of proteins, the nudix motif has diverged to lack the essential glutamate residues and therefore lack hydrolase function. NUDT16L1 has been found to bind with weak affinity to the cytoplasmic domain of syndecan 4 and participate in the formation of focal adhesions. Perhaps more importantly, NUDT16L1 interacts with the IRIF region of TRP53BP1 and regulates its recruitment to double-stranded breaks for DNA repair. This strain was generated by the Knockout Mouse Phenotyping Program (KOMP³) at The Jackson Laboratory using CRISPR technology. This deletion of exons 1-3 is predicted to generate a null allele. As mice are characterized, phenotype data will be accessible on the International Mouse Phenotyping Consortium website.

Development

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTCCAGCTCAAGTGACAG and CTGAGGGCAACCAATCTCAG, which resulted in a 2443 bp deletion beginning at Chromosome 16 position 4,938,671 bp and ending after 4,941,113 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001438399, ENSMUSE00000127761, and ENSMUSE00001442417 (exons 1-3) and 825 bp of flanking and intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. This allele was sequenced in the C57BL/6NJ N1 offspring from the founder and was backcrossed a second time to C57BL/6NJ before sperm was cryopreserved from heterozygous males at generation N2.

Allele

Symbol: Nudt16l1^em1(IMPC)J
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:7343888
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Nudt16l1
Marker name: nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Marker synonyms: 1110001K21Rik; 5330437I08Rik; nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1; SDOS; syndesmos; TIRR
Chromosome: 16
Strain of origin: C57BL/6NJ
Molecular note: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTCCAGCTCAAGTGACAG and CTGAGGGCAACCAATCTCAG, which resulted in a 2443 bp deletion beginning at Chromosome 16 position 4,938,671 bp and ending after 4,941,113 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001438399, ENSMUSE00000127761, and ENSMUSE00001442417 (exons 1-3) and 825 bp of flanking and intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.